Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ornithorhynchus anatinus (platypus) oan-miR-29b-3p URS00004D1411_9258

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Ornithorhynchus anatinus. Annotated by 4 databases (RefSeq, ENA, MirGeneDB, miRBase). Described in 6 papers. Ornithorhynchus anatinus (platypus) oan-miR-29b-3p sequence is a product of miR-29b, MIR29B-1, MIR29B-2, miR-29b-3p, oan-miR-29b, miR-29, oan-miR-29b-3p genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAGCACCAUUUGAAAUCAGUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 39 other species

    1. Chrysemys picta bellii Cpi-Mir-29-P2a_3p (mature (guide))
    2. Danio rerio (zebrafish) dre-miR-29b
    3. Gadus morhua gmo-miR-29b-3p
    4. Haplochromis burtoni abu-miR-29b
    5. Monodelphis domestica (gray short-tailed opossum) mdo-miR-29b-3p
    6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72546
    7. Oreochromis niloticus (Nile tilapia) oni-miR-29b
    8. Oryzias latipes (Japanese medaka) ola-miR-29b
    9. Ovis aries oar-miR-29b
    10. Petromyzon marinus (sea lamprey) pma-miR-29c
    11. Ptychodera flava Pfl-Mir-29-P2_3p (mature (guide))
    12. Pundamilia nyererei pny-miR-29b
    13. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-62878
    14. Saccoglossus kowalevskii sko-miR-29b-3p
    15. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-29-P2a_3p (mature (guide))
    16. Scyliorhinus torazame Sto-Mir-29-P2b_3p (mature (guide))
    17. Takifugu rubripes (torafugu) fru-miR-29b
    18. Tetraodon nigroviridis tni-miR-29b
    19. Tor tambroides (Thai mahseer) miR-29b
    20. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-29-P2b_3p (mature (guide))