Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-29b URS00004D1411_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 5 databases (miRBase, PSICQUIC, RefSeq, MirGeneDB, ENA). Described in 11 papers. Danio rerio (zebrafish) dre-miR-29b sequence is a product of dre-miR-29b, mir29b-1, miR-29, mir29b-2, miR-29b genes. Found in the zebrafish reference genome.

Interactions 10

According to PSICQUIC, Danio rerio (zebrafish) dre-miR-29b interacts with:

Interaction id Participant Synonyms
URS00004D1411_7955-0 B0S553 B0S553
URS00004D1411_7955-5 B0S553 B0S553
URS00004D1411_7955-1 F1QBT2 F1QBT2
URS00004D1411_7955-6 F1QBT2 F1QBT2
URS00004D1411_7955-2 F1QX88 F1QX88
URS00004D1411_7955-7 F1QX88 F1QX88
URS00004D1411_7955-8 Q08CB3 Q08CB3
URS00004D1411_7955-3 Q08CB3 Q08CB3
URS00004D1411_7955-4 Q7SZP4 Q7SZP4
URS00004D1411_7955-9 Q7SZP4 Q7SZP4

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAGCACCAUUUGAAAUCAGUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 39 other species

    1. Chrysemys picta bellii Cpi-Mir-29-P2a_3p (mature (guide))
    2. Gadus morhua gmo-miR-29b-3p
    3. Haplochromis burtoni abu-miR-29b
    4. Monodelphis domestica (gray short-tailed opossum) mdo-miR-29b-3p
    5. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72546
    6. Oreochromis niloticus (Nile tilapia) oni-miR-29b
    7. Ornithorhynchus anatinus oan-miR-29b-3p
    8. Oryzias latipes (Japanese medaka) ola-miR-29b
    9. Ovis aries oar-miR-29b
    10. Petromyzon marinus (sea lamprey) pma-miR-29c
    11. Ptychodera flava Pfl-Mir-29-P2_3p (mature (guide))
    12. Pundamilia nyererei pny-miR-29b
    13. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-62878
    14. Saccoglossus kowalevskii sko-miR-29b-3p
    15. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-29-P2a_3p (mature (guide))
    16. Scyliorhinus torazame Sto-Mir-29-P2b_3p (mature (guide))
    17. Takifugu rubripes (torafugu) fru-miR-29b
    18. Tetraodon nigroviridis tni-miR-29b
    19. Tor tambroides (Thai mahseer) miR-29b
    20. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-29-P2b_3p (mature (guide))