Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-710 URS00004D0A2E_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-710: Mmu-mir-710 is a microRNA that does not have an annotated homologue in the human microRNAome and its mature sequence does not appear to be conserved [PMC6910689]. In a study, it was found that mmu-mir-710 does not harbor the predicted target binding site for STIM1/2 or Orai1 and therefore, did not affect SOCE [PMC5685687]. The study also showed that mmu-mir-710 lacks the predicted binding site in STIM2 or Orai1 3’UTR region and did not influence their transcription [PMC5685687]. However, mmu-mir-710 was found to have 508 predicted targets related to cell cycle, cytoskeletal remodeling, invasion and migration, and stemness [PMC6910689]. In murine metastatic breast cancer cells, mmu-mir-710 was shown to have a broad-based and significant effect [PMC6910689]. The study suggests the possibility of employing miRNAs like mmu-mir-710 for therapy since it is not naturally present in the genome but has potential targets in both murine and human systems [PMC6910689]. Additionally, it has been shown that mmu-mir-710 enhances the differentiation of murine embryonic stem cells [PMC6910689]. References: [PMC5685687] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5685687/ [PMC6910689] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6910689/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAAGUCUUGGGGAGAGUUGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications