Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-498-5p URS00004CCA62_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (GeneCards, IntAct, miRBase, LncBase, ENA, RefSeq, MirGeneDB, MalaCards, TarBase). Described in 35 papers. Homo sapiens (human) hsa-miR-498-5p sequence is a product of HSA-MIR-RG-87 variant 2, MIR498, miR-498, miR-498-5p, hsa-miR-498, hsa-miR-498-5p, MIR-RG-87 variant 2 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1A6/DRIM, ABITRAM, ADTB2, AFURS1, AHNAK, ALEX3, AP2B1, APRO2, ARA70, ARFGEF2.

Interactions 1

According to IntAct, Homo sapiens (human) hsa-miR-498-5p interacts with:

IntAct ID Participant Synonyms
EBI-25425796 intact:EBI-25420098 EBI-25420098 ENST00000627532 mrna_zeb2

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUUCAAGCCAGGGGGCGUUUUUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 2 other species

    1. Macaca mulatta mml-miR-498
    2. Pan troglodytes ptr-miR-498
    3. Pongo pygmaeus (Bornean orangutan) ppy-miR-498