Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-133a-3p URS00004C9052_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (TarBase, GeneCards, MalaCards, IntAct, ENA, miRBase, RefSeq). Described in 81 papers. Homo sapiens (human) hsa-miR-133a-3p sequence is a product of MIR133A2, MIR133A1, miR-133a, miR-133, miR-133a-1, miR-133a-3p, 133a-1, hsa-miR-133a, hsa-miR-133a-3p genes. Found in the human reference genome. Interacts with protein-coding genes, including 1-Cys, 133K02, 14-3-3, 14-3-3-zeta, 2F1, 2H9, 4E-BP1, 5-HT3A, 5-HT3R, 80K-L.

Interactions 1

According to IntAct, Homo sapiens (human) hsa-miR-133a-3p interacts with:

IntAct ID Participant Synonyms
EBI-20626676 intact:EBI-20626719 EBI-20626719 ENST00000361505.9 mrna_pnp

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUUGGUCCCCUUCAACCAGCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 20 other species

    1. Alligator mississippiensis (American alligator) ami-miR-133a-3p
    2. Anolis carolinensis aca-miR-133a-3p
    3. Bos taurus bta-miR-133a
    4. Callorhinchus milii (elephant shark) cmi-miR-133-2
    5. Chrysemys picta bellii Cpi-Mir-133-P4-v1_3p (mature (guide))
    6. Chrysemys picta cpi-miR-133c-3p
    7. Ciona intestinalis Cin-Mir-133_3p (mature (guide))
    8. Columba livia Cli-Mir-133-P4-v1_3p (mature (guide))
    9. Danio rerio (zebrafish) dre-miR-133a-3p
    10. Equus caballus eca-miR-133a
    11. Gallus gallus (chicken) Gga-Mir-133-P4-v1_3p (mature (guide))
    12. Macaca mulatta mml-miR-133c-3p
    13. Mus musculus mmu-miR-133a-3p
    14. Ophiophagus hannah (king cobra) oha-miR-133a-3p
    15. Pan troglodytes ptr-miR-133a
    16. Pongo pygmaeus (Bornean orangutan) ppy-miR-133c
    17. Rattus norvegicus rno-miR-133a-3p
    18. Scyliorhinus torazame (cloudy catshark) Sto-Mir-133-P4-v1_3p (mature (guide))
    19. Taeniopygia guttata Tgu-Mir-133-P4-v1_3p (mature (guide))
    20. Takifugu rubripes (torafugu) fru-miR-133
    21. Tetraodon nigroviridis tni-miR-133