Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callorhinchus milii (elephant shark) cmi-miR-133-2 URS00004C9052_7868

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Callorhinchus milii. Annotated by 1 database (ENA). Described in 1 paper. Callorhinchus milii (elephant shark) cmi-miR-133-2 sequence is a product of miR-133-2, cmi-miR-133-2 genes. Found in the elephant shark reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUUGGUCCCCUUCAACCAGCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 43 other species

    1. Alligator mississippiensis ami-miR-133a-3p
    2. Anolis carolinensis aca-miR-133a
    3. Bos taurus (cattle) bta-miR-133a
    4. Chrysemys picta bellii Cpi-Mir-133-P4-v1_3p (mature (guide))
    5. Chrysemys picta cpi-miR-133c-3p
    6. Ciona intestinalis Cin-Mir-133_3p (mature (guide))
    7. Columba livia Cli-Mir-133-P4-v1_3p (mature (guide))
    8. Danio rerio dre-miR-133a-3p
    9. Equus caballus eca-miR-133a
    10. Gallus gallus (chicken) Gga-Mir-133-P4-v1_3p (mature (guide))
    11. Homo sapiens (human) hsa-miR-133a-3p
    12. Macaca mulatta mml-miR-133c-3p
    13. Mus musculus mmu-miR-133a-3p
    14. Ophiophagus hannah oha-miR-133a-3p
    15. Pan troglodytes (chimpanzee) ptr-miR-133a
    16. Pongo pygmaeus ppy-miR-133c
    17. Rattus norvegicus rno-miR-133a-3p
    18. Scyliorhinus torazame (cloudy catshark) Sto-Mir-133-P4-v1_3p (mature (guide))
    19. Taeniopygia guttata (zebra finch) Tgu-Mir-133-P4-v1_3p (mature (guide))
    20. Takifugu rubripes fru-miR-133
    21. Tetraodon nigroviridis tni-miR-133