Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-549a-3p URS00004C689A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-549a: Hsa-mir-549a is a microRNA that has been found to be significantly differentially expressed among different groups and is up-regulated [PMC5952410]. It has also been identified as one of the significantly differentially expressed miRNAs in glioblastoma tumor tissue and controls [PMC9737249]. Hsa-mir-549a is included in a miRNA risk score calculation for prognostic purposes [PMC9264898]. It has been found to have target genes identified through small RNA-seq analysis [PMC9264898]. Hsa-mir-549a is one of the candidate miRNAs for gastric cancer diagnosis [PMC7882724]. It has also been shown to be significantly decreased in ME/CFS PBMCs [PMC7005890]. Hsa-mir-549a, along with hsa-miR-548ba and hsa-miR-4521, have been identified as novel miRNAs that are deregulated in certain conditions [PMC8900545]. In the context of miRNA-mRNA interaction networks, hsa-mir-549a has a high degree and may be involved in the pathogenesis of certain diseases, such as Huntington's disease [PMC6102687]. References: [PMC5952410] [PMC9737249] [PMC9264898] [PMC7882724] [PMC7005890] [PMC8900545] [PM6102687]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGACAACUAUGGAUGAGCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Pan troglodytes ptr-miR-549
  2. Pongo pygmaeus ppy-miR-549
Publications