Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1287-5p URS00004C5774_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1287: Hsa-mir-1287 is a microRNA that has been studied in various contexts [PMC4695119]. Overexpression of hsa-miR-657 and downexpression of hsa-mir-1287 have been shown to effectively distinguish between early larynx carcinoma and normal mucosa tissues, indicating their potential as biomarkers [PMC4695119]. Hsa-mir-1287 has also been found to regulate CD105 expression and control osteopotential in SHED (stem cells from human exfoliated deciduous teeth) [PMC8184333]. Additionally, a study demonstrated sequence conservation in hsa-mir-1287, as well as a novel candidate atypical mirtron miRNA (MELmiRNA_293) [PMC2837346]. Microarray-based screening revealed that hsa-miR-657 and hsa-mir-1287 are highly deregulated in early laryngeal carcinoma and normal esophageal mucosa tissues, suggesting their potential as diagnostic markers for laryngeal malignancies at early stages [PMC7279294]. Furthermore, microarray analysis identified a two-miRNA signature consisting of hsa-miR-657 and hsa-mir-1287 as an effective predictive biomarker for early diagnosis of laryngeal cancer [PMC5642505]. Additionally, the stable overexpression of hsa-miR-557 and hsa-mir-1287 has been shown to increase the production of IgG and recombinant human serum albumin in CHO cells [PMC8977551].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCUGGAUCAGUGGUUCGAGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications