Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-32-5p URS00004C47FB_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (GeneCards, miRBase, LncBase, ENA, RefSeq, MirGeneDB, MalaCards, TarBase). Described in 51 papers. Homo sapiens (human) hsa-miR-32-5p sequence is a product of miR-32-5p, hsa-miR-32-5p, hsa-miR-32, MIR32, miR-32 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 13CDNA73, 156DAG, 16E1BP, 182-FIP, 2B28, 2HOR0202, 6A3-5, 82-FIP, 87U6, A1.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAUUGCACAUUACUAAGUUGCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 19 other species

    1. Alligator mississippiensis (American alligator) ami-miR-32-5p
    2. Anolis carolinensis aca-miR-32-5p
    3. Canis lupus familiaris Cfa-Mir-32_5p (mature (guide))
    4. Cervus elaphus (red deer) cel-miR-32
    5. Chrysemys picta bellii Cpi-Mir-32_5p (mature (guide))
    6. Chrysemys picta cpi-miR-32-5p
    7. Columba livia cli-miR-32-5p
    8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-32-5p
    9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-32_5p (mature (guide))
    10. Equus caballus eca-miR-32
    11. Gallus gallus (chicken) Gga-Mir-32_5p (mature (guide))
    12. Macaca mulatta Mml-Mir-32_5p (mature (guide))
    13. Monodelphis domestica Mdo-Mir-32_5p (mature (guide))
    14. Mus musculus mmu-miR-32-5p
    15. Ornithorhynchus anatinus Oan-Mir-32_5p (mature (guide))
    16. Oryctolagus cuniculus (rabbit) ocu-miR-32-5p
    17. Rattus norvegicus rno-miR-32-5p
    18. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-32_5p (mature (guide))
    19. Taeniopygia guttata Tgu-Mir-32_5p (mature (guide))
    20. Tupaia chinensis (Chinese tree shrew) tch-miR-32-5p