Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Spermophilus tridecemlineatus (thirteen-lined ground squirrel) mir-105 microRNA precursor family URS00004C3DB1_43179

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGCAUCGUGGUCAAAUGCUCAGACUCCUGUGGUGGCUGCUCAUGCACCACGGAUGUUUGAGCAUGUGCUACGGUGUCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000006508.1)
  2. Carlito syrichta miRNA (ENSTSYG00000031450.1)
  3. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000000944.1)
  4. Chlorocebus sabaeus (African green monkey) microRNA 105-1 (ENSCSAG00000020509.1)
  5. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000017086.1)
  6. Gorilla gorilla gorilla ggo-mir-105 (ENSGGOG00000036460.1)
  7. Gorilla gorilla microRNA ggo-mir-105 precursor
  8. Homo sapiens microRNA hsa-mir-105 precursor (hsa-mir-105-1)
  9. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-105 precursor
  10. Macaca fascicularis microRNA 105-1 (ENSMFAG00000060927.1)
  11. Macaca mulatta (Rhesus monkey) microRNA mml-mir-105 precursor (mml-mir-105-1)
  12. Macaca nemestrina microRNA mne-mir-105 precursor
  13. Mandrillus leucophaeus miRNA (ENSMLEG00000020205.1)
  14. Marmota marmota marmota (Alpine marmot) microRNA 105-1 (ENSMMMG00000011889.1)
  15. Marmota monax non-coding RNA
  16. Microcebus murinus microRNA 105-1 (ENSMICG00000041793.1)
  17. Nomascus leucogenys microRNA 105-1 (ENSNLEG00000035541.1)
  18. Otolemur garnettii miRNA (ENSOGAG00000025481.1)
  19. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-105 precursor
  20. Pan troglodytes miRNA (ENSPTRG00000044607.1, ENSPTRG00000052058.1)
  21. Papio anubis miRNA (ENSPANG00000051344.1)
  22. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 105-1 (ENSPTEG00000021485.1)
  23. Pongo abelii miRNA (ENSPPYG00000035238.1)
  24. Pongo pygmaeus microRNA ppy-mir-105 precursor (ppy-mir-105-1)
  25. Prolemur simus microRNA 105-1 (ENSPSMG00000026015.1)
  26. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000010318.1)
  27. Rhinopithecus bieti miRNA (ENSRBIG00000014880.1)
  28. Rhinopithecus roxellana (Golden snub-nosed monkey) microRNA 105-1 (ENSRROG00000009638.1)
  29. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-105 precursor
  30. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000001280.1)
  31. Sciurus vulgaris (Eurasian red squirrel) microRNA 105-1 (ENSSVLG00005022295.1)
  32. Spermophilus dauricus (Daurian ground squirrel) miRNA (ENSSDAG00000011876.1)
  33. Theropithecus gelada (gelada) microRNA 105-1 (ENSTGEG00000008235.1)
  34. Tupaia belangeri microRNA 105-1 (ENSTBEG00000017919.1)
  35. Tupaia chinensis mir-105 microRNA precursor family
  36. Urocitellus parryii microRNA 105-1 (ENSUPAG00010020240.1)
Publications