Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-548i URS00004C1D89_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-548i: Hsa-mir-548i is a member of the hsa-mir-548 family of microRNAs. It has been shown to be downregulated by greater than 16-fold in basal cell carcinomas (BCCs) [PMC8357504]. The hsa-miR-548 family, including hsa-mir-548i, has been found to regulate cancer processes at both the gene expression and single nucleotide polymorphism (SNP) level [PMC8357504]. In a study on heart failure, hsa-mir-548i was identified as a potential novel biomarker [PMC8256614]. In patients with severe asthma, hsa-mir-548i was found to be differentially expressed between those treated with oral corticosteroids (OCS) and those not treated with OCS [PMC9864670]. Hsa-mir-548i is involved in the regulation of the "PIP3 activates AKT signaling" pathway in both granulosa cells and mural granulosa cells [PMC8501715]. It has also been detected in other body fluids, such as follicular fluid [PMC8501715]. Hsa-mir-548i is one of several miRNAs that are highly expressed and exhibit increased expression in certain conditions, such as cancer [PMC6884461]. In patients with chronic obstructive pulmonary disease (COPD), hsa-mir-548i was downregulated along with other miRNAs in different patient groups [PMC9889280]. References: [PMC8357504]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8357504/ [PMC8256614]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8256614/ [PMC9864670]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9864670/ [PMC8501715]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8501715/ [PMC6884461]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6884461/ [PMC9889280]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9889280/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAGUAAUUGCGGAUUUUGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-548i
Publications