Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens let-7f-1 stem-loop (hsa-let-7f-1) URS00004BFD1E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIRLET7F1: MIRLET7F1 is a microRNA gene that is included in a custom gene panel designed for mutation profiling of pediatric cancers [PMC7341754]. The panel includes coding exons of 366 cancer-associated genes, untranslated regions and introns of 16 genes for detecting structural variations, and specific regions for detecting TERT rearrangement and promoter/enhancer mutation [PMC7341754]. In addition, the panel includes the promoter and enhancer regions of FGFR3 and MYC, as well as 11 microRNA genes including MIRLET7F1 [PMC7341754]. In a study, MIRLET7F1 was identified as one of the candidate target genes in pediatric cancers [PMC5791735]. MIRLET7F1 interacts with HNRNPM along with other miRNAs, protein coding genes, rRNAs, lncRNAs, and pseudogenes [PMC9730017]. The SNP rs10512230 is flanked by the PTPDC1 gene along with MIRLET7A1 (Let-7a-1), MIRLET7F1 (Let-7f-1), and MIRLET7D (Let-7d) genes [PMC6202974]. These microRNA genes including MIRLET7A1, MIRLET7F1, and MIRLET7D are involved in cancer and DNA damage response pathways [PMC6202974]. The custom gene panel used targeted capture technology to analyze various genomic regions including microRNA genes like MIRLET7F1 for copy number analysis in pediatric cancers [PMC7815088].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGAGUGAGGUAGUAGAUUGUAUAGUUGUGGGGUAGUGAUUUUACCCUGUUCAGGAGAUAACUAUACAAUCUAUUGCCUUCCCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 60 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000013330.1)
  2. Balaenoptera musculus microRNA let-7f-1 (ENSBMSG00010006243.1)
  3. Bos taurus let-7f-1 stem-loop (bta-let-7f-1)
  4. Callithrix jacchus let-7 microRNA precursor
  5. Camelus ferus let-7 microRNA precursor
  6. Canis lupus familiaris let-7 microRNA precursor
  7. Capra hircus (Goat) microRNA let-7f (ENSCHIG00000009011.1)
  8. Carlito syrichta miRNA (ENSTSYG00000021948.2)
  9. Cebus imitator (Panamanian white-faced capuchin) microRNA let-7f-1 (ENSCCAG00000016223.1)
  10. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000016195.1)
  11. Chlorocebus sabaeus let-7 microRNA precursor
  12. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000008705.1)
  13. Cricetulus griseus (Chinese hamster) let-7 microRNA precursor
  14. Delphinapterus leucas (beluga whale) microRNA let-7f-1 (ENSDLEG00000009233.1)
  15. Dipodomys ordii (Ord's kangaroo rat) let-7 microRNA precursor
  16. Felis catus (domestic cat) let-7 microRNA precursor
  17. Fukomys damarensis (Damara mole-rat) let-7 microRNA precursor
  18. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA let-7f-1 (ENSGGOG00000032887.2)
  19. Gorilla gorilla (western gorilla) precursor microRNA let-7f-1
  20. Lagothrix lagotricha (brown woolly monkey) precursor microRNA let-7f-1
  21. Lemur catta (Ring-tailed lemur) precursor microRNA let-7f-1
  22. Macaca mulatta let-7f-1 stem-loop (mml-let-7f-1)
  23. Macaca nemestrina miRNA (ENSMNEG00000002240.1)
  24. Mandrillus leucophaeus miRNA (ENSMLEG00000013151.1)
  25. Marmota monax non-coding RNA
  26. Meriones unguiculatus miRNA (ENSMUGG00000014781.1)
  27. Mesocricetus auratus (golden hamster) let-7 microRNA precursor
  28. Microcebus murinus microRNA let-7f-1 (ENSMICG00000018146.3)
  29. Monodelphis domestica let-7f-1 stem-loop (mdo-let-7f-1)
  30. Monodon monoceros (narwhal) microRNA let-7f-1 (ENSMMNG00015013892.1)
  31. Mustela putorius furo miRNA (ENSMPUG00000020641.1)
  32. Neogale vison miRNA (ENSNVIG00000014765.1)
  33. Nomascus leucogenys microRNA let-7f-1 (ENSNLEG00000022324.2)
  34. Notamacropus eugenii microRNA let-7f-1 (ENSMEUG00000017286.1)
  35. Ochotona princeps (American pika) miRNA (ENSOPRG00000017439.1, ENSOPRG00000018731.1)
  36. Oryctolagus cuniculus (rabbit) let-7 microRNA precursor
  37. Otolemur garnettii miRNA (ENSOGAG00000017294.1)
  38. Ovis aries let-7 microRNA precursor
  39. Pan paniscus (bonobo) microRNA let-7f-1 (ENSPPAG00000007666.1)
  40. Panthera pardus (leopard) microRNA let-7f-1 (ENSPPRG00000014667.1)
  41. Panthera tigris altaica miRNA (ENSPTIG00000001463.1)
  42. Pan troglodytes ptr-let-7f-1 (ENSPTRG00000027785.3)
  43. Papio anubis (Olive baboon) let-7 microRNA precursor
  44. Phocoena sinus microRNA let-7f-1 (ENSPSNG00000003601.1)
  45. Physeter catodon microRNA let-7f-1 (ENSPCTG00005009367.1)
  46. Pongo abelii let-7 microRNA precursor
  47. Pongo pygmaeus let-7f-1 stem-loop (ppy-let-7f-1)
  48. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000008326.1)
  49. Pteropus alecto let-7 microRNA precursor
  50. Pteropus vampyrus (large flying fox) miRNA (ENSPVAG00000027657.1)
  51. Rhinopithecus bieti miRNA (ENSRBIG00000008268.1)
  52. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000002770.1)
  53. Saguinus labiatus (red-chested mustached tamarin) precursor microRNA let-7f-1
  54. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000018655.1)
  55. Sarcophilus harrisii microRNA let-7f-1 (ENSSHAG00000019362.2)
  56. Ictidomys tridecemlineatus let-7 microRNA precursor
  57. Sus scrofa let-7 microRNA precursor
  58. Tupaia belangeri miRNA (ENSTBEG00000017944.1)
  59. Tupaia chinensis let-7 microRNA precursor
  60. Tursiops truncatus (bottlenosed dolphin) miRNA (ENSTTRG00000021522.1)
Publications