v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) miscellaneous RNA URS00004BCD9C_9940

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UAGCAGCACGUAAAUAUUGGCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 36 other species

    1. Ateles geoffroyi age-miR-16
    2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-16
    3. Callorhinchus milii (elephant shark) eshark_mir-15_1
    4. Canis lupus familiaris (dog) cfa-miR-16
    5. Capra hircus (goat) miR-16
    6. Cervus elaphus cel-miR-16b
    7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-15-P2a_5p (mature (guide))
    8. Chrysemys picta cpi-miR-16a-5p
    9. Cricetulus griseus (Chinese hamster) cgr-miR-16-5p
    10. Daubentonia madagascariensis dma-miR-16
    11. Equus caballus (horse) eca-miR-16
    12. Gorilla gorilla (western gorilla) ggo-miR-16
    13. Homo sapiens (human) hsa-miR-16-5p
    14. Lagothrix lagotricha (brown woolly monkey) lla-miR-16
    15. Macaca mulatta (Rhesus monkey) mml-miR-16-5p
    16. Macaca nemestrina mne-miR-16
    17. Maylandia zebra mze-miR-16a
    18. Monodelphis domestica (gray short-tailed opossum) mdo-miR-16-5p
    19. Mus musculus mmu-miR-16-5p
    20. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-16
    21. Oreochromis niloticus (Nile tilapia) oni-miR-16a
    22. Ornithorhynchus anatinus oan-miR-16a-5p
    23. Otolemur garnettii (small-eared galago) oga-miR-16
    24. Pan paniscus (pygmy chimpanzee) ppa-miR-16
    25. Pan troglodytes ptr-miR-16
    26. Papio hamadryas pha-miR-16
    27. Petromyzon marinus (sea lamprey) Pma-Mir-15-P2o1_5p (mature (guide))
    28. Pongo pygmaeus (Bornean orangutan) microRNA mir-16-1
    29. Pteropus alecto (black flying fox) pal-miR-16-5p
    30. Rattus norvegicus (Norway rat) rno-miR-16-5p
    31. Saguinus labiatus sla-miR-16
    32. Saimiri boliviensis boliviensis sbo-miR-16
    33. Salmo salar (Atlantic salmon) ssa-miR-16c-5p
    34. Sarcophilus harrisii Sha-Mir-15-P2a_5p (mature (guide))
    35. Scyliorhinus torazame (cloudy catshark) Sto-Mir-15-P2b_5p (mature (guide))
    36. Sus scrofa ssc-miR-16
    37. Gorilla gorilla gorilla None