Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callorhinchus milii (elephant shark) eshark_mir-15_1 URS00004BCD9C_7868

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Callorhinchus milii. Annotated by 1 database (ENA). Described in 1 paper. Found in the elephant shark reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAGCAGCACGUAAAUAUUGGCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 66 other species

    1. Ateles geoffroyi (black-handed spider monkey) age-miR-16
    2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-16
    3. Canis lupus familiaris (dog) cfa-miR-16
    4. Capra hircus miR-16
    5. Cervus elaphus (red deer) cel-miR-16b
    6. Chrysemys picta bellii Cpi-Mir-15-P2a_5p (mature (guide))
    7. Chrysemys picta cpi-miR-16a-5p
    8. Cricetulus griseus (Chinese hamster) cgr-miR-16-5p
    9. Daubentonia madagascariensis dma-miR-16
    10. Equus caballus eca-miR-16
    11. Gorilla gorilla (western gorilla) ggo-miR-16
    12. Homo sapiens (human) hsa-miR-16-5p
    13. Lagothrix lagotricha (brown woolly monkey) lla-miR-16
    14. Macaca mulatta mml-miR-16-5p
    15. Macaca nemestrina mne-miR-16
    16. Maylandia zebra (zebra mbuna) mze-miR-16a
    17. Monodelphis domestica (gray short-tailed opossum) mdo-miR-16-5p
    18. Mus musculus mmu-miR-16-5p
    19. Nomascus leucogenys nle-miR-16
    20. Oreochromis niloticus (Nile tilapia) oni-miR-16a
    21. Ornithorhynchus anatinus oan-miR-16a-5p
    22. Otolemur garnettii oga-miR-16
    23. Ovis aries (sheep) miscellaneous RNA
    24. Pan paniscus ppa-miR-16
    25. Pan troglodytes (chimpanzee) ptr-miR-16
    26. Papio hamadryas pha-miR-16
    27. Pongo pygmaeus microRNA mir-16-1
    28. Pteropus alecto (black flying fox) pal-miR-16-5p
    29. Rattus norvegicus rno-miR-16-5p
    30. Saguinus labiatus sla-miR-16
    31. Saimiri boliviensis boliviensis sbo-miR-16
    32. Salmo salar ssa-miR-16c-5p
    33. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-15-P2a_5p (mature (guide))
    34. Scyliorhinus torazame (cloudy catshark) Sto-Mir-15-P2b_5p (mature (guide))
    35. Sus scrofa ssc-miR-16