Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Daubentonia madagascariensis (aye-aye) dma-miR-16 URS00004BCD9C_31869

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Daubentonia madagascariensis. Annotated by 1 database (miRBase).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAGCAGCACGUAAAUAUUGGCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 36 other species

    1. Ateles geoffroyi (black-handed spider monkey) age-miR-16
    2. Callithrix jacchus cja-miR-16
    3. Callorhinchus milii (elephant shark) eshark_mir-15_1
    4. Canis lupus familiaris cfa-miR-16
    5. Capra hircus (goat) miR-16
    6. Cervus elaphus (red deer) cel-miR-16b
    7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-15-P2a_5p (mature (guide))
    8. Chrysemys picta (Painted turtle) cpi-miR-16a-5p
    9. Cricetulus griseus cgr-miR-16-5p
    10. Equus caballus eca-miR-16
    11. Gorilla gorilla (western gorilla) ggo-miR-16
    12. Homo sapiens hsa-miR-16-5p
    13. Lagothrix lagotricha lla-miR-16
    14. Macaca mulatta mml-miR-16-5p
    15. Macaca nemestrina (pig-tailed macaque) mne-miR-16
    16. Maylandia zebra mze-miR-16a
    17. Monodelphis domestica mdo-miR-16-5p
    18. Mus musculus (house mouse) mmu-miR-16-5p
    19. Nomascus leucogenys nle-miR-16
    20. Oreochromis niloticus oni-miR-16a
    21. Ornithorhynchus anatinus oan-miR-16a-5p
    22. Otolemur garnettii oga-miR-16
    23. Ovis aries miscellaneous RNA
    24. Pan paniscus (pygmy chimpanzee) ppa-miR-16
    25. Pan troglodytes ptr-miR-16
    26. Papio hamadryas pha-miR-16
    27. Petromyzon marinus Pma-Mir-15-P2o1_5p (mature (guide))
    28. Pongo pygmaeus (Bornean orangutan) microRNA mir-16-1
    29. Pteropus alecto (black flying fox) pal-miR-16-5p
    30. Rattus norvegicus rno-miR-16-5p
    31. Saguinus labiatus sla-miR-16
    32. Saimiri boliviensis boliviensis sbo-miR-16
    33. Salmo salar ssa-miR-16c-5p
    34. Sarcophilus harrisii Sha-Mir-15-P2a_5p (mature (guide))
    35. Scyliorhinus torazame Sto-Mir-15-P2b_5p (mature (guide))
    36. Sus scrofa (pig) ssc-miR-16