Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-16-5p URS00004BCD9C_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 8 databases (PirBase, miRBase, IntAct, LncBase, ENA, RefSeq, MirGeneDB, TarBase). Described in 53 papers. Mus musculus (house mouse) mmu-miR-16-5p sequence is a product of mmu-miR-16-5p, Mir16-2, miR-16-5p, mmu-miR-16, 16, miR-16, Mir16-1 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including (homologous Alu RNA binding protein), 0610006H08Rik, 0610007L03Rik, 0610009B22Rik, 0610009E20Rik, 0610009F02Rik, 0610010H08Rik, 0610011E17Rik, 0610011L14Rik, 0610012C09Rik.

Interactions 1

According to IntAct, Mus musculus (house mouse) mmu-miR-16-5p interacts with:

IntAct ID Participant Synonyms
EBI-21016276 intact:EBI-21016268 EBI-21016268 ENSMUST00000026999.9 mrna_smad7

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAGCAGCACGUAAAUAUUGGCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 34 other species

    1. Ateles geoffroyi age-miR-16
    2. Callithrix jacchus cja-miR-16
    3. Callorhinchus milii (elephant shark) eshark_mir-15_1
    4. Canis lupus familiaris cfa-miR-16
    5. Capra hircus (goat) miR-16
    6. Cervus elaphus (red deer) cel-miR-16b
    7. Chrysemys picta bellii Cpi-Mir-15-P2a_5p (mature (guide))
    8. Chrysemys picta cpi-miR-16a-5p
    9. Cricetulus griseus cgr-miR-16-5p
    10. Daubentonia madagascariensis dma-miR-16
    11. Equus caballus eca-miR-16
    12. Gorilla gorilla ggo-miR-16
    13. Homo sapiens hsa-miR-16-5p
    14. Lagothrix lagotricha lla-miR-16
    15. Macaca mulatta mml-miR-16-5p
    16. Macaca nemestrina mne-miR-16
    17. Maylandia zebra (zebra mbuna) mze-miR-16a
    18. Monodelphis domestica mdo-miR-16-5p
    19. Nomascus leucogenys nle-miR-16
    20. Oreochromis niloticus (Nile tilapia) oni-miR-16a
    21. Ornithorhynchus anatinus oan-miR-16a-5p
    22. Otolemur garnettii (small-eared galago) oga-miR-16
    23. Ovis aries (sheep) miscellaneous RNA
    24. Pan paniscus ppa-miR-16
    25. Pan troglodytes ptr-miR-16
    26. Papio hamadryas (hamadryas baboon) pha-miR-16
    27. Pongo pygmaeus (Bornean orangutan) microRNA mir-16-1
    28. Pteropus alecto pal-miR-16-5p
    29. Rattus norvegicus rno-miR-16-5p
    30. Saguinus labiatus (red-chested mustached tamarin) sla-miR-16
    31. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-16
    32. Salmo salar (Atlantic salmon) ssa-miR-16c-5p
    33. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-15-P2a_5p (mature (guide))
    34. Scyliorhinus torazame (cloudy catshark) Sto-Mir-15-P2b_5p (mature (guide))
    35. Sus scrofa ssc-miR-16