Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-16-5p URS00004BCD9C_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 8 databases (IntAct, ENA, TarBase, PirBase, miRBase, LncBase, RefSeq, MirGeneDB). Mus musculus (house mouse) mmu-miR-16-5p sequence is a product of miR-16, miR-16-5p, 16, mmu-miR-16, Mir16-2, mmu-miR-16-5p, Mir16-1 genes. Found in the house mouse reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including (homologous Alu RNA binding protein), 0610006H08Rik, 0610007L03Rik, 0610009B22Rik, 0610009E20Rik, 0610009F02Rik, 0610010H08Rik, 0610011E17Rik, 0610011L14Rik, 0610012C09Rik.

Interactions 14

According to PSICQUIC and IntAct, Mus musculus (house mouse) mmu-miR-16-5p interacts with:

Interaction id Participant Synonyms
EBI-21016276 intact:EBI-21016268 EBI-21016268 ENSMUST00000026999.9 mrna_smad7
URS00004BCD9C_10090-0 P01580 P01580
URS00004BCD9C_10090-7 P01580 P01580
URS00004BCD9C_10090-1 P06804 P06804
URS00004BCD9C_10090-8 P06804 P06804
URS00004BCD9C_10090-5 P12023 P12023
URS00004BCD9C_10090-2 P12023 P12023
URS00004BCD9C_10090-9 P12023 P12023
URS00004BCD9C_10090-10 P43432 P43432
URS00004BCD9C_10090-3 P43432 P43432
URS00004BCD9C_10090-6 P56818 P56818
URS00004BCD9C_10090-11 P56818 P56818
URS00004BCD9C_10090-4 P57716 P57716
URS00004BCD9C_10090-12 P57716 P57716

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAGCAGCACGUAAAUAUUGGCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 36 other species

    1. Ateles geoffroyi age-miR-16
    2. Callithrix jacchus cja-miR-16
    3. Callorhinchus milii eshark_mir-15_1
    4. Canis lupus familiaris cfa-miR-16
    5. Capra hircus (goat) miR-16
    6. Cervus elaphus (red deer) cel-miR-16b
    7. Chrysemys picta bellii Cpi-Mir-15-P2a_5p (mature (guide))
    8. Chrysemys picta (Painted turtle) cpi-miR-16a-5p
    9. Cricetulus griseus cgr-miR-16-5p
    10. Daubentonia madagascariensis (aye-aye) dma-miR-16
    11. Equus caballus eca-miR-16
    12. Gorilla gorilla (western gorilla) ggo-miR-16
    13. Homo sapiens (human) hsa-miR-16-5p
    14. Lagothrix lagotricha (brown woolly monkey) lla-miR-16
    15. Macaca mulatta mml-miR-16-5p
    16. Macaca nemestrina mne-miR-16
    17. Maylandia zebra mze-miR-16a
    18. Monodelphis domestica mdo-miR-16-5p
    19. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-16
    20. Oreochromis niloticus oni-miR-16a
    21. Ornithorhynchus anatinus (platypus) oan-miR-16a-5p
    22. Otolemur garnettii (small-eared galago) oga-miR-16
    23. Ovis aries (sheep) miscellaneous RNA
    24. Pan paniscus ppa-miR-16
    25. Pan troglodytes (chimpanzee) ptr-miR-16
    26. Papio hamadryas pha-miR-16
    27. Petromyzon marinus Pma-Mir-15-P2o1_5p (mature (guide))
    28. Pongo pygmaeus (Bornean orangutan) microRNA mir-16-1
    29. Pteropus alecto (black flying fox) pal-miR-16-5p
    30. Rattus norvegicus rno-miR-16-5p
    31. Saguinus labiatus sla-miR-16
    32. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-16
    33. Salmo salar ssa-miR-16c-5p
    34. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-15-P2a_5p (mature (guide))
    35. Scyliorhinus torazame (cloudy catshark) Sto-Mir-15-P2b_5p (mature (guide))
    36. Sus scrofa (pig) ssc-miR-16
    Publications New