Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens let-7a-3 stem-loop (hsa-let-7a-3) secondary structure diagram

Homo sapiens let-7a-3 stem-loop (hsa-let-7a-3) URS00004BC34C_9606

  • 74 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 23 species

Automated summary: This pre miRNA sequence is 74 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (GeneCards, Ensembl/GENCODE, Ensembl, miRBase, HGNC, ENA, RefSeq, MalaCards). Described in 35 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (let-7, RF00027). Homo sapiens let-7a-3 stem-loop (hsa-let-7a-3) sequence is a product of let-7a-3, let-7a-3 precursor, 7a-3, hsa-let-7a-3 precursor, let-7a-3 precurso, MIRLET7A3 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGGUGAGGUAGUAGGUUGUAUAGUUUGGGGCUCUGCCCUGCUAUGGGAUAACUAUACAAUCUACUGUCUUUCCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 22 other species

    1. Bos grunniens (domestic yak) microRNA let-7a-3
    2. Bos indicus x Bos taurus microRNA let-7a-3
    3. Bos mutus microRNA let-7a-3
    4. Bos taurus let-7a-3 stem-loop (bta-let-7a-3)
    5. Capra hircus (Goat) microRNA let-7a (MIRLET7A)
    6. Carlito syrichta (Philippine tarsier) miRNA
    7. Cercocebus atys (Sooty mangabey) miRNA
    8. Colobus angolensis palliatus miRNA
    9. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA let-7a-3
    10. Macaca fascicularis (Crab-eating macaque) miRNA
    11. Macaca mulatta let-7a-3 stem-loop (mml-let-7a-3)
    12. Macaca nemestrina miRNA
    13. Mandrillus leucophaeus (Drill) miRNA
    14. Nomascus leucogenys (Northern white-cheeked gibbon) nle-let-7a-1
    15. Ochotona princeps miRNA
    16. Pan paniscus (bonobo) ppa-let-7a-1
    17. Pan troglodytes (chimpanzee) ptr-let-7a-3
    18. Papio anubis (Olive baboon) miRNA
    19. Pongo abelii microRNA let-7a-3
    20. Pongo pygmaeus let-7a-3 stem-loop (ppy-let-7a-3)
    21. Propithecus coquereli (Coquerel's sifaka) miRNA
    22. Pteropus vampyrus miRNA
    23. Rhinopithecus bieti miRNA
    24. Rhinopithecus roxellana miRNA
    2D structure New