Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens let-7a-3 stem-loop (hsa-let-7a-3) URS00004BC34C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIRLET7A3: MIRLET7A3 is a gene that belongs to the MIRLET7A gene family, which also includes MIRLET7A1 and MIRLET7A2 [PMC7459851]. It is located at 22q12.31 within the MIRLET7BHG gene [PMC6353855]. The hypermethylation of the MIRLET7A3 gene has been reported in various cancers, including acute myeloid leukemia, ovarian cancer, and breast cancer [PMC6353855]. In hepatocellular carcinoma (HCC), the CpG island in the MIRLET7A3 gene is hypermethylated compared to healthy liver tissue [PMC6353855]. The deletion of the 22q13.31 region where MIRLET7A3 maps is frequently observed in ovarian tumors [PMC5400605]. In breast carcinomas, hypermethylation of the super-enhancer region associated with MIRLET7B and MIRLET7A3 leads to their transcriptional silencing [PMC4728783]. The array Comparative Genomic Hybridization study identified three genes expressing let-7a: MIRLET7A1 on 9q22.3, MIRLET7A2 on 11q24.1, and MIRLET7A3 on 22q13.3 [PMC5356719]. A custom gene panel was designed to include microRNA genes such as MIR100, MIRETLETA1-2-3-B-C-D-E-F-G for mutation profiling of pediatric cancers [PMC7341754]. Mutations in IL6 and LIN28a genes were also investigated but no mutations were found in these genes associated with IL-6 regulatory pathway [PMC3601972].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGUGAGGUAGUAGGUUGUAUAGUUUGGGGCUCUGCCCUGCUAUGGGAUAACUAUACAAUCUACUGUCUUUCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

Publications