Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-548g-5p URS00004BC299_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-548g: Hsa-mir-548g is a candidate miRNA that contains putative binding sites on circNOL10, as shown in a Venn diagram [PMC7780627]. The expressions of 14 miRNAs, including hsa-mir-548g, located on chromosome 21 were evaluated [PMC4823505]. U6-snRNA was used as the control sample for normalization in this evaluation [PMC5863254]. In a study, the 10 highest-ranking candidate miRNAs were identified, and hsa-mir-548g was one of them [PMC6948356]. Furthermore, hsa-mir-548g was identified in exosomes obtained from normal pregnancies at early gestation and exosomes derived from EVT cultured at 8% oxygen [PMC5370130]. Finally, in an expression analysis study, the primer used was hsa-mir-548g [PMC8591040].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCAAAAGUAAUUGCAGUUUUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications