Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pundamilia nyererei pny-miR-455 URS00004BBAB0_303518

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUGUGCCCUUGGACUACAUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Alligator mississippiensis ami-miR-455-5p
  2. Anolis carolinensis aca-miR-455-5p
  3. Callorhinchus milii (elephant shark) Cmi-Mir-455_5p (mature (guide))
  4. Chrysemys picta bellii Cpi-Mir-455_5p (mature (guide))
  5. Chrysemys picta (Painted turtle) cpi-miR-455-5p
  6. Columba livia Cli-Mir-455_5p (mature (guide))
  7. Cyprinus carpio ccr-miR-455
  8. Danio rerio dre-miR-455-5p
  9. Gadus morhua (Atlantic cod) Gmo-Mir-455-P1_5p (mature (guide))
  10. Gallus gallus (chicken) gga-miR-455-5p
  11. Gekko japonicus Gja-Mir-455_5p (mature (guide))
  12. Haplochromis burtoni abu-miR-455
  13. Ictalurus punctatus ipu-miR-455a
  14. Latimeria chalumnae (coelacanth) Lch-Mir-455_5p (mature (guide))
  15. Lepisosteus oculatus Loc-Mir-455_5p (mature (guide))
  16. Maylandia zebra (zebra mbuna) mze-miR-455
  17. Microcaecilia unicolor Mun-Mir-455_5p (mature (guide))
  18. Monodelphis domestica mdo-miR-455-5p
  19. Monopterus albus Mal-Mir-455-P1_5p (mature (guide))
  20. Neolamprologus brichardi (lyretail cichlid) nbr-miR-455
  21. Ophiophagus hannah (king cobra) oha-miR-455-5p
  22. Oreochromis niloticus (Nile tilapia) oni-miR-455
  23. Ornithorhynchus anatinus (platypus) Oan-Mir-455_5p (mature (guide))
  24. Python bivittatus Pbv-Mir-455_5p (mature (guide))
  25. Salmo salar (Atlantic salmon) ssa-miR-455-5p
  26. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-455_5p (mature (guide))
  27. Scyliorhinus torazame (cloudy catshark) Sto-Mir-455_5p (mature (guide))
  28. Sphenodon punctatus (tuatara) Spt-Mir-455_5p (mature (guide))
  29. Taeniopygia guttata tgu-miR-455-5p
  30. Takifugu rubripes fru-miR-455
  31. Tetraodon nigroviridis tni-miR-455
  32. Tor tambroides miR-455-5p
  33. Xenopus laevis (African clawed frog) Xla-Mir-455-P3_5p (mature (guide))
  34. Xenopus tropicalis (tropical clawed frog) xtr-miR-455