Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gadus morhua (Atlantic cod) Gmo-Mir-455-P1_5p (mature (guide)) URS00004BBAB0_8049

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Gadus morhua. Annotated by 1 database (MirGeneDB). Found in the Gadus morhua reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAUGUGCCCUUGGACUACAUCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 34 other species

    1. Alligator mississippiensis (American alligator) ami-miR-455-5p
    2. Anolis carolinensis (green anole) aca-miR-455-5p
    3. Callorhinchus milii (elephant shark) Cmi-Mir-455_5p (mature (guide))
    4. Chrysemys picta bellii (western painted turtle) Cpi-Mir-455_5p (mature (guide))
    5. Chrysemys picta (Painted turtle) cpi-miR-455-5p
    6. Columba livia (rock pigeon) Cli-Mir-455_5p (mature (guide))
    7. Cyprinus carpio ccr-miR-455
    8. Danio rerio dre-miR-455-5p
    9. Gallus gallus (chicken) gga-miR-455-5p
    10. Gekko japonicus Gja-Mir-455_5p (mature (guide))
    11. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-455
    12. Ictalurus punctatus (channel catfish) ipu-miR-455a
    13. Latimeria chalumnae (coelacanth) Lch-Mir-455_5p (mature (guide))
    14. Lepisosteus oculatus (spotted gar) Loc-Mir-455_5p (mature (guide))
    15. Maylandia zebra mze-miR-455
    16. Microcaecilia unicolor Mun-Mir-455_5p (mature (guide))
    17. Monodelphis domestica mdo-miR-455-5p
    18. Monopterus albus Mal-Mir-455-P1_5p (mature (guide))
    19. Neolamprologus brichardi nbr-miR-455
    20. Ophiophagus hannah oha-miR-455-5p
    21. Oreochromis niloticus oni-miR-455
    22. Ornithorhynchus anatinus Oan-Mir-455_5p (mature (guide))
    23. Pundamilia nyererei pny-miR-455
    24. Python bivittatus Pbv-Mir-455_5p (mature (guide))
    25. Salmo salar ssa-miR-455-5p
    26. Sarcophilus harrisii Sha-Mir-455_5p (mature (guide))
    27. Scyliorhinus torazame Sto-Mir-455_5p (mature (guide))
    28. Sphenodon punctatus (tuatara) Spt-Mir-455_5p (mature (guide))
    29. Taeniopygia guttata (zebra finch) tgu-miR-455-5p
    30. Takifugu rubripes fru-miR-455
    31. Tetraodon nigroviridis tni-miR-455
    32. Tor tambroides miR-455-5p
    33. Xenopus laevis (African clawed frog) Xla-Mir-455-P3_5p (mature (guide))
    34. Xenopus tropicalis (tropical clawed frog) xtr-miR-455