Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR167f URS00004B5529_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR167d-5p: Osa-mir167d-5p is a miRNA that has been found to be differentially expressed in fungal-infected resistant genotypes of rice [PMC7662745]. It is one of the miRNAs that showed preferential expression in these genotypes [PMC7662745]. Additionally, osa-mir167d-5p was found to be up-regulated by >6-fold in miRNA sequencing results [PMC6042804]. The expression of osa-mir167d-5p was also verified through qRT-PCR experiments, which showed consistent results with the sequencing data [PMC7037501]. It has been reported that rice dwarf virus (RDV) and rice stripe virus (RSV) can induce the accumulation of osa-mir167d-5p [PMC7037501]. Furthermore, osa-mir167d-5p has been shown to be involved in rice immunity response and may play a role in regulating susceptibility to Xoo infection by suppressing the expression of its target gene, OsWD40-174 [PMC7037501]. The regulatory mechanism and role of osa-mir167d-5p in rice immunity response are still not fully understood and require further investigation [PMC7037501]. Overall, multiple miRNAs/targets regulatory units are responsive to Xoo infection, and osa-miR164a, osa-mir167d-5p, and osa-miR159b have been confirmed to have defensive roles against Xoo attack [PMC7037501].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAAGCUGCCAGCAUGAUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Amborella trichopoda atr-miR167
  2. Ananas comosus microRNA 167h
  3. Arabidopsis thaliana (thale cress) Ath_wt_13786
  4. Asparagus officinalis (garden asparagus) aof-miR167c
  5. Citrus sinensis csi-miR167a-5p
  6. Cucumis melo (muskmelon) cme-miR167d
  7. Cynara cardunculus var. scolymus cca-miR167b
  8. Digitalis purpurea (common foxglove) dpr-miR167c
  9. Glycine max gma-miR167j
  10. Glycine soja (wild soybean) gso-miR167a
  11. Hevea brasiliensis partial microRNA 167a
  12. Linum usitatissimum lus-miR167g
  13. Lotus japonicus lja-miR167
  14. Manihot esculenta (cassava) mes-miR167a
  15. Medicago truncatula (barrel medic) mtr-miR167b-5p
  16. Nicotiana attenuata microRNA mir-167-like
  17. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR167d-5p
  18. Populus tomentosa Pto-miR167e
  19. Populus trichocarpa ptc-miR167e
  20. Prunus persica (peach) microRNA miRNA_117
  21. Saccharum officinarum (sugarcane) sof-miR167a
  22. Saccharum sp. ssp-miR167b
  23. Sorghum bicolor (sorghum) sbi-miR167h
  24. Vitis vinifera (wine grape) vvi-miR167a
  25. Zea mays (maize) zma-miR167e-5p
Publications