Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saccharum sp. ssp-miR167b URS00004B5529_15819

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAAGCUGCCAGCAUGAUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Amborella trichopoda atr-miR167
  2. Ananas comosus microRNA 167h
  3. Arabidopsis thaliana (thale cress) Ath_wt_13786
  4. Asparagus officinalis (garden asparagus) aof-miR167c
  5. Citrus sinensis csi-miR167a-5p
  6. Cucumis melo (muskmelon) cme-miR167d
  7. Cynara cardunculus var. scolymus cca-miR167b
  8. Digitalis purpurea (common foxglove) dpr-miR167c
  9. Glycine max gma-miR167j
  10. Glycine soja (wild soybean) gso-miR167a
  11. Hevea brasiliensis partial microRNA 167a
  12. Linum usitatissimum lus-miR167g
  13. Lotus japonicus lja-miR167
  14. Manihot esculenta (cassava) mes-miR167a
  15. Medicago truncatula (barrel medic) mtr-miR167b-5p
  16. Nicotiana attenuata microRNA mir-167-like
  17. Oryza sativa (Asian cultivated rice) osa-miR167f
  18. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR167d-5p
  19. Populus tomentosa Pto-miR167e
  20. Populus trichocarpa ptc-miR167e
  21. Prunus persica (peach) microRNA miRNA_117
  22. Saccharum officinarum (sugarcane) sof-miR167a
  23. Sorghum bicolor (sorghum) sbi-miR167h
  24. Vitis vinifera (wine grape) vvi-miR167a
  25. Zea mays (maize) zma-miR167e-5p
Publications