Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR167d-5p URS00004B5529_39947

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Oryza sativa Japonica Group. Annotated by 1 database (ENA). Described in 1 paper. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR167d-5p sequence is a product of osa-miR167i-5p, osa-miR167d, osa-miR167d-5p, osa-miR167i, miR167i-5p, miR167d, miR167h, miR167i, miR167h-5p, osa-miR167h, osa-miR167j, miR167e, miR167j, miR167e-5p, miR167, miR167f, osa-miR167e-5p, miR167g, osa-miR167e, osa-miR167g, osa-miR167h-5p, miR167d-5p, osa-miR167f genes. Found in the japanese rice reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAAGCUGCCAGCAUGAUCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 24 other species

    1. Amborella trichopoda atr-miR167
    2. Ananas comosus microRNA 167h
    3. Arabidopsis thaliana Ath_wt_13786
    4. Asparagus officinalis (garden asparagus) aof-miR167c
    5. Citrus sinensis csi-miR167c-5p
    6. Cucumis melo (muskmelon) cme-miR167f
    7. Cynara cardunculus var. scolymus cca-miR167b
    8. Digitalis purpurea dpr-miR167c
    9. Glycine max gma-miR167j
    10. Glycine soja gso-miR167a
    11. Hevea brasiliensis (rubber tree) partial microRNA 167a
    12. Linum usitatissimum (flax) lus-miR167f
    13. Lotus japonicus lja-miR167
    14. Manihot esculenta (cassava) mes-miR167a
    15. Medicago truncatula (barrel medic) mtr-miR167b-5p
    16. Nicotiana attenuata microRNA mir-167-like
    17. Oryza sativa osa-miR167f
    18. Populus tomentosa Pto-miR167e
    19. Populus trichocarpa (black cottonwood) ptc-miR167e
    20. Prunus persica (peach) microRNA miRNA_117
    21. Saccharum officinarum sof-miR167a
    22. Saccharum sp. ssp-miR167b
    23. Sorghum bicolor sbi-miR167g
    24. Vitis vinifera (wine grape) vvi-miR167a
    25. Zea mays zma-miR167i-5p