Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-let-7-5p URS00004B50F3_7227

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Drosophila melanogaster. Annotated by 5 databases (FlyBase, PirBase, RefSeq, ENA, miRBase). Described in 13 papers. Drosophila melanogaster (fruit fly) dme-let-7-5p sequence is a product of let7-R, dme-let-7-5p, let-7-5p, 7, FBgn0262406, mir-let7-RA, let7-RA, mir-let7, let-7, dme-let-7 genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAGGUAGUAGGUUGUAUAGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 43 other species

    1. Apis mellifera (honey bee) ame-let-7-5p
    2. Bactrocera dorsalis bdo-let-7
    3. Bombyx mori bmo-let-7-5p
    4. Caenorhabditis briggsae let-7 RNA
    5. Caenorhabditis elegans let-7 RNA
    6. Capitella teleta cte-let-7
    7. Cochliomyia hominivorax (primary screw-worm) mature cho-let-7-5p
    8. Cochliomyia macellaria (secondary screw-worm) mature cma-let-7-5p
    9. Dinoponera quadriceps dqu-let-7-5p
    10. Drosophila ananassae dan-let-7
    11. Drosophila erecta der-let-7
    12. Drosophila grimshawi dgr-let-7
    13. Drosophila mojavensis dmo-let-7
    14. Drosophila persimilis dpe-let-7
    15. Drosophila pseudoobscura dps-let-7
    16. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294455_df_nrg
    17. Drosophila sechellia dse-let-7
    18. Drosophila simulans dsi-let-7
    19. Drosophila virilis dvi-let-7
    20. Drosophila willistoni dwi-let-7
    21. Drosophila yakuba dya-let-7
    22. Gorilla gorilla ggo-let-7a
    23. Ixodes scapularis (black-legged tick) isc-let-7
    24. Mus musculus Mus_musculus piRNA piR-mmu-72408
    25. Nasonia giraulti ngi-let-7
    26. Nasonia vitripennis nvi-let-7
    27. Oryzias latipes (Japanese medaka) ola-let-7a-5p
    28. Ovis aries microRNA let-7a
    29. Platynereis dumerilii let-7
    30. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-62870
    31. Sarcophilus harrisii sha-let-7a
    32. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-5094987