Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-532-3p URS00004B4B85_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-532: Hsa-mir-532 is a microRNA that has been found to be involved in various biological processes and diseases. It has been shown to suppress migration and proliferation in renal cell carcinoma (RCC) by targeting insulin-like growth factor 1 receptor (IGF1R) and nucleosome assembly protein 1-like 1 (NAP1L1) [PMC8490801]. In a study that analyzed differentially expressed microRNAs in RCC, hsa-mir-532 was found to be down-regulated [PMC5041965]. It has also been identified as a potential biomarker in different studies [PMC8844910]. In pancreatic islets, hsa-mir-532 exhibited lower DNA methylation and higher expression levels in females compared to males [PMC4256841]. Furthermore, hsa-mir-532 has been shown to target genes involved in the Gata3 signaling pathway [PMC4359317]. In patients with complex regional pain syndrome (CRPS) Type-2, higher levels of hsa-mir-532 were observed compared to CRPS Type-1 patients [PMC3228853]. Additionally, hsa-mir-532 was found to be significantly associated with overall survival in various cancer types, including breast cancer and pancreatic ductal adenocarcinoma (PDAC) [PMC7897818] [PMC9780260] [PMC8613738]. It has also been identified as differentially expressed between normal and tumor cells in multiple myeloma-associated vasculopathy (MMVP) specimens [PMC4881574]. Hsa-mir-532 is clustered with other microRNAs such as hsa-mir-188, hsa-mir-362, and hsa-mir-660 [miRDB] and has opposite effects on proteins like NF-kB compared to other influenza viruses.

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUCCCACACCCAAGGCUUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Cavia porcellus (domestic guinea pig) cpo-miR-532-3p
  2. Cervus elaphus cel-miR-532-3p
  3. Dasypus novemcinctus (nine-banded armadillo) dno-miR-532-3p
  4. Equus caballus eca-miR-532-3p
  5. Macaca mulatta (Rhesus monkey) mml-miR-532-3p
  6. Mus musculus mmu-miR-532-3p
  7. Oryctolagus cuniculus ocu-miR-532-3p
  8. Pan troglodytes (chimpanzee) ptr-miR-532
  9. Pongo pygmaeus ppy-miR-532-3p
  10. Pteropus alecto (black flying fox) pal-miR-532-3p
  11. Rattus norvegicus rno-miR-532-3p
  12. Sus scrofa ssc-miR-532-3p
Publications