Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis thaliana (thale cress) ath-miR168a-3p URS00004B4991_3702

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCGCCUUGCAUCAACUGAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Arabidopsis lyrata (lyrate rockcress) aly-miR168a-3p
  2. Brassica rapa (field mustard) bra-miR168b-3p
  3. Camelina sativa cas-miR168
  4. Citrus sinensis csi-miR168-3p
  5. Cynara cardunculus var. scolymus cca-miR168b
  6. Fragaria vesca subsp. vesca fve-miR168-3p
  7. Medicago truncatula (barrel medic) mtr-miR168c-3p
  8. Populus tomentosa Pto-miR168b-3p
  9. Populus trichocarpa ptc-miR168a-3p
  10. Prunus persica (peach) microRNA miRNA_366
  11. Solanum lycopersicum sly-miR168b-3p
Publications