Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-1307 URS00004B1671_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-1307: ssc-mir-1307 is a microRNA that has been identified in the SSC14 region, along with two other microRNAs (ssc-miR-436 and ssc-miR-146b) and four lincRNA genes [PMC6399881]. It has been found to interact with several miRNAs, including ssc-miR-1343, ssc-miR-652, ssc-miR-1249, and circRNA_010551 [PMC7222767]. In terms of gene regulation, up-regulated ssc-mir-1307 targets 12 genes, while down-regulated ssc-miR-361-3p targets only one gene [PMC7490888]. The expression of ssc-mir-1307 and ssc-miR-1343 in ovarian tissue has not been reported in previous studies [PMC7490888]. These two microRNAs (ssc-mir-1307 and ssc-miR-1343) have shown significant up-regulation in the LL group compared to the LH group [PMC7490888]. They also play central roles in the regulation network [PMC7490888]. In addition to their roles in gene regulation, these microRNAs are involved in signaling pathways such as NF-kB and JAK/STAT pathways [PMC7820490]. Notably, the expression patterns of ssc-mir-1307 along with other miRNAs (ssc-miR10a5p and sscmi-R30d) have been observed as particularly noteworthy phenomena [PMC7820490]. Furthermore, IL17F/IL17RC genes are potentially regulated by these miRNAs at different time points during infection [PMC8851844].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUCGGCGUGGCGUCGGUCGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Bos taurus bta-miR-1307
  2. Canis lupus familiaris cfa-miR-1307
  3. Homo sapiens hsa-miR-1307-3p
  4. Macaca fascicularis microRNA miR-1307-3p
  5. Pan troglodytes (chimpanzee) ptr-miR-1307
  6. Pongo pygmaeus ppy-miR-1307
Publications