Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-1307 URS00004B1671_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-1307: Bta-mir-1307 is a functional miRNA that plays a role in controlling target genes in various signaling pathways, including TGF-β, GnRH, PI3K-Akt, MAPK, Wnt, and AMPK [PMC9940382]. It is one of the miRNAs that target genes in the Wnt signaling pathway and is also enriched in the TGF-β signaling pathways [PMC9940382]. In the GnRH signaling pathway, bta-mir-1307 is among the most multifunctional miRNAs controlling target genes [PMC9940382]. Bta-mir-1307 has been found to be significantly correlated with 12 pathways and shows differences in abundance between datasets [PMC9378797] [PMC4682966]. In a comparison of different groups, bta-mir-1307 was found to be differentially expressed in the H_ARM comparison [PMC10000098]. In summary, bta-mir-1307 is a functional miRNA that plays a role in various signaling pathways including TGF-β, GnRH, PI3K-Akt, MAPK, Wnt and AMPK. It targets genes involved in the Wnt and TGF-β signaling pathways. Bta-mir-1307 also shows differences in abundance between datasets and has been found to be differentially expressed in certain comparisons.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUCGGCGUGGCGUCGGUCGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Canis lupus familiaris cfa-miR-1307
  2. Homo sapiens hsa-miR-1307-3p
  3. Macaca fascicularis microRNA miR-1307-3p
  4. Pan troglodytes (chimpanzee) ptr-miR-1307
  5. Pongo pygmaeus ppy-miR-1307
  6. Sus scrofa ssc-miR-1307
Publications