Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (MalaCards, miRBase, GeneCards, MirGeneDB, TarBase, ENA, RefSeq, LncBase). Homo sapiens (human) hsa-let-7g-5p sequence is a product of let-7, hsa-let-7g, let-7g-5p, MIRLET7G, let-7g, hsa-let-7g-5p genes. Found in the Homo sapiens reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 15.5K, 182-FIP, 2'-PDE, 225, 2610509L04Rik, 2C4D.
According to PSICQUIC, Homo sapiens (human) hsa-let-7g-5p interacts with:
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
UGAGGUAGUAGUUUGUACAGUU
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.