Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ornithorhynchus anatinus (platypus) oan-let-7g-5p URS00004AFF8D_9258

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Ornithorhynchus anatinus. Annotated by 4 databases (RefSeq, miRBase, MirGeneDB, ENA). Ornithorhynchus anatinus (platypus) oan-let-7g-5p sequence is a product of let-7, oan-let-7g, let-7g-5p, MIRLET7G, oan-let-7g-5p, let-7g genes. Found in the Ornithorhynchus anatinus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAGGUAGUAGUUUGUACAGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 42 other species

    1. Alligator mississippiensis (American alligator) ami-let-7g-5p
    2. Anolis carolinensis (green anole) aca-let-7g
    3. Bos taurus bta-let-7g
    4. Callithrix jacchus cja-let-7g
    5. Canis lupus familiaris cfa-let-7g
    6. Capra hircus (goat) chi-let-7g-5p
    7. Cavia porcellus (domestic guinea pig) cpo-let-7g-5p
    8. Cervus elaphus (red deer) cel-let-7g
    9. Chrysemys picta bellii (western painted turtle) Cpi-Let-7-P2c3_5p (mature (guide))
    10. Chrysemys picta (Painted turtle) cpi-let-7g-5p
    11. Columba livia (rock pigeon) cli-let-7g-5p
    12. Cricetulus griseus cgr-let-7g-5p
    13. Dasypus novemcinctus (nine-banded armadillo) dno-let-7g-5p
    14. Daubentonia madagascariensis dma-let-7g
    15. Echinops telfairi Ete-Let-7-P2c3_5p (mature (guide))
    16. Equus caballus eca-let-7g
    17. Gallus gallus (chicken) Gga-Let-7-P2c3_5p (mature (guide))
    18. Gekko japonicus Gja-Let-7-P2c3_5p (mature (guide))
    19. Homo sapiens hsa-let-7g-5p
    20. Latimeria chalumnae (coelacanth) Lch-Let-7-P2c3_5p (mature (guide))
    21. Macaca mulatta mml-let-7g-5p
    22. Microcaecilia unicolor Mun-Let-7-P2c3_5p (mature (guide))
    23. Microcebus murinus (gray mouse lemur) mmr-let-7g
    24. Monodelphis domestica Mdo-Let-7-P2c3_5p (mature (guide))
    25. Mus musculus (house mouse) mmu-let-7g-5p
    26. Nomascus leucogenys nle-let-7g
    27. Ophiophagus hannah oha-let-7g-5p
    28. Oryctolagus cuniculus ocu-let-7g-5p
    29. Otolemur garnettii oga-let-7g
    30. Pan paniscus (pygmy chimpanzee) ppa-let-7g
    31. Pan troglodytes ptr-let-7g
    32. Papio hamadryas pha-let-7g
    33. Pongo pygmaeus (Bornean orangutan) ppy-let-7g
    34. Pteropus alecto (black flying fox) pal-let-7g-5p
    35. Python bivittatus pbv-let-7g-5p
    36. Rattus norvegicus rno-let-7g-5p
    37. Sarcophilus harrisii Sha-Let-7-P2c3_5p (mature (guide))
    38. Sphenodon punctatus (tuatara) Spt-Let-7-P2c3_5p (mature (guide))
    39. Sus scrofa (pig) ssc-let-7g
    40. Taeniopygia guttata (zebra finch) tgu-let-7g-5p
    41. Tupaia chinensis (Chinese tree shrew) tch-let-7g-5p
    42. Xenopus laevis (African clawed frog) xla-let-7g
    Publications