Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-15b-5p URS00004AD914_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (GeneCards, RefSeq, MalaCards, ENA, MirGeneDB, TarBase, LncBase, IntAct, miRBase, PSICQUIC). Described in 81 papers. Homo sapiens (human) hsa-miR-15b-5p sequence is a product of miR-15b-5p, hsa-miR-15b-5p, miR-15b, hsa-miR-15b, MIR15B, miR-15 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, 14-3-3GAMMA, 14-3-3γ, 15E1.2, 182-FIP, 2'-PDE, 2700066J21Rik, 2C4D, 2OST, 2P1.

Interactions 30

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-15b-5p interacts with:

Interaction id Participant Synonyms
EBI-25684181 intact:EBI-20558404 EBI-20558404 ENST00000650285 mrna_igf1r
URS00004AD914_9606-18 O14757 O14757
URS00004AD914_9606-0 O14757 O14757
URS00004AD914_9606-19 O15111 O15111
URS00004AD914_9606-1 O15111 O15111
URS00004AD914_9606-2 O15111 O15111
URS00004AD914_9606-17 P06213 P06213
URS00004AD914_9606-20 P06213 P06213
URS00004AD914_9606-16 P06213 P06213
URS00004AD914_9606-21 P10415 P10415
URS00004AD914_9606-3 P10415 P10415
URS00004AD914_9606-4 P15692 P15692
URS00004AD914_9606-22 P19838 P19838
URS00004AD914_9606-5 P19838 P19838
URS00004AD914_9606-6 P23443 P23443
URS00004AD914_9606-23 P23443 P23443
URS00004AD914_9606-7 P24864 P24864
URS00004AD914_9606-8 P30291 P30291
URS00004AD914_9606-24 P30291 P30291
URS00004AD914_9606-9 P35968 P35968
URS00004AD914_9606-25 P35968 P35968
URS00004AD914_9606-12 P56817 P56817
URS00004AD914_9606-10 P56817 P56817
URS00004AD914_9606-26 P56817 P56817
URS00004AD914_9606-27 P56817 P56817
URS00004AD914_9606-11 P56817 P56817
URS00004AD914_9606-13 Q8N5C8 Q8N5C8
URS00004AD914_9606-14 Q9UKV8 Q9UKV8
URS00004AD914_9606-28 Q9Y243 Q9Y243
URS00004AD914_9606-15 Q9Y243 Q9Y243

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAGCAGCACAUCAUGGUUUACA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 44 other species

    1. Ateles geoffroyi (black-handed spider monkey) age-miR-15b
    2. Bos taurus (cattle) bta-miR-15b
    3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-15b
    4. Canis lupus familiaris (dog) Cfa-Mir-15-P1b_5p (mature (guide))
    5. Capra hircus chi-miR-15b-5p
    6. Cervus elaphus (red deer) cel-miR-15b
    7. Cricetulus griseus (Chinese hamster) cgr-miR-15b-5p
    8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-15b-5p
    9. Echinops telfairi Ete-Mir-15-P1b_5p (mature (guide))
    10. Eptesicus fuscus (big brown bat) efu-miR-15
    11. Equus caballus eca-miR-15b
    12. Gorilla gorilla (western gorilla) ggo-miR-15b
    13. Lagothrix lagotricha (brown woolly monkey) lla-miR-15b
    14. Macaca mulatta mml-miR-15b-5p
    15. Macaca nemestrina mne-miR-15b
    16. Mus musculus mmu-miR-15b-5p
    17. Nomascus leucogenys nle-miR-15b
    18. Oryctolagus cuniculus ocu-miR-15b-5p
    19. Otolemur garnettii oga-miR-15b
    20. Ovis aries (sheep) miscellaneous RNA
    21. Pan paniscus ppa-miR-15b
    22. Pan troglodytes (chimpanzee) ptr-miR-15b
    23. Pongo pygmaeus ppy-miR-15b
    24. Pteropus alecto (black flying fox) pal-miR-15b-5p
    25. Rattus norvegicus rno-miR-15b-5p
    26. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-15-P1b_5p (mature (guide))
    27. Sus scrofa ssc-miR-15b
    28. Tupaia chinensis (Chinese tree shrew) tch-miR-15b-5p