Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-15b-5p URS00004AD914_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 8 databases (RefSeq, ENA, PSICQUIC, PirBase, LncBase, MirGeneDB, TarBase, miRBase). Described in 37 papers. Mus musculus (house mouse) mmu-miR-15b-5p sequence is a product of miR-15, miR-15b, Mir15b, mmu-miR-15b-5p, 15b, mmu-miR-15b, 15, miR-15b-5p genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including (homologous Alu RNA binding protein), 0610009E20Rik, 0610009F02Rik, 0610011E17Rik, 0610011L14Rik, 0610025L18Rik, 0610027A18Rik, 0610027D24Rik, 0610030G24Rik, 0610031G08Rik.

Interactions 2

According to PSICQUIC, Mus musculus (house mouse) mmu-miR-15b-5p interacts with:

Interaction id Participant Synonyms
URS00004AD914_10090-0 P01580 P01580
URS00004AD914_10090-1 P01580 P01580

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAGCAGCACAUCAUGGUUUACA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 44 other species

    1. Ateles geoffroyi (black-handed spider monkey) age-miR-15b
    2. Bos taurus (cattle) bta-miR-15b
    3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-15b
    4. Canis lupus familiaris (dog) Cfa-Mir-15-P1b_5p (mature (guide))
    5. Capra hircus chi-miR-15b-5p
    6. Cervus elaphus (red deer) cel-miR-15b
    7. Cricetulus griseus (Chinese hamster) cgr-miR-15b-5p
    8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-15b-5p
    9. Echinops telfairi Ete-Mir-15-P1b_5p (mature (guide))
    10. Eptesicus fuscus (big brown bat) efu-miR-15
    11. Equus caballus eca-miR-15b
    12. Gorilla gorilla (western gorilla) ggo-miR-15b
    13. Homo sapiens (human) hsa-miR-15b-5p
    14. Lagothrix lagotricha (brown woolly monkey) lla-miR-15b
    15. Macaca mulatta mml-miR-15b-5p
    16. Macaca nemestrina mne-miR-15b
    17. Nomascus leucogenys nle-miR-15b
    18. Oryctolagus cuniculus ocu-miR-15b-5p
    19. Otolemur garnettii oga-miR-15b
    20. Ovis aries (sheep) miscellaneous RNA
    21. Pan paniscus ppa-miR-15b
    22. Pan troglodytes (chimpanzee) ptr-miR-15b
    23. Pongo pygmaeus ppy-miR-15b
    24. Pteropus alecto (black flying fox) pal-miR-15b-5p
    25. Rattus norvegicus rno-miR-15b-5p
    26. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-15-P1b_5p (mature (guide))
    27. Sus scrofa ssc-miR-15b
    28. Tupaia chinensis (Chinese tree shrew) tch-miR-15b-5p