Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 1 (SNORA1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 1 (SNORA1) URS00004ACFCF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA1: SNORA1 is a small nucleolar RNA (snoRNA) that has been identified as having interactions with mRNAs in various data sets [PMC4931010]. It has been detected both as enzymatically processed small RNAs and in ARGONAUTE HITS-CLIP data [PMC4931010]. Specifically, an interaction between the 3' untranslated region of Trim25 mRNA and SNORA1 snoRNA was supported by multiple paired-end reads [PMC4931010]. SNORA1 is one of the snoRNAs expressed in hPDLSCs-MOR, but not in hPDLSCs-CTR [PMC6767209]. It acts as a regulatory factor through methylation and pseudouridylation [PMC6767209]. SNORA1 is also one of the small nucleolar RNAs (snoRNAs) represented among a majority of non-coding RNAs [PMC5747948]. Some ncRNAs, including SNORA1, could not be validated by RT-PCR due to containing multiple isoforms [PMC5085052]. In a proposed rule, SNORA1 is one of the effective parameters identified [PMC6539089]. In summary, SNORA1 is a snoRNA that has been found to interact with mRNAs and play regulatory roles through methylation and pseudouridylation. It has been detected in various data sets and expressed in specific cell types. However, its validation through RT-PCR may be challenging due to its multiple isoforms. Additionally, it has been identified as an effective parameter in a proposed rule.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCUCAUUCUAGAGAAUGGGCACUGUUGAUCAUGGUGUCCAAAAAUAGUUAAUGUGGCUAAAUUGAGACAGGUUAUGCUUCCAUCACAGUAUGCAUAUUGCAGUGGUGACAAUGAGACCUGUAACAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications