Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1912-3p URS00004A9320_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1912: Hsa-mir-1912 is a miRNA that has been found to be up-regulated in certain conditions [PMC6921333]. In a study, it was identified as one of the up-regulated miRNAs along with hsa-mir-383, hsa-mir-490, hsa-mir-488, hsa-mir-1265 [PMC6921333]. Another study also confirmed the up-regulation of hsa-mir-1912 along with hsa-miR-31-5p, hsa-miR-224-5p, hsa-miR-205-5p, and others [PMC7378055]. The expression of hsa-mir-1912 was found to be significantly increased after etoposide treatment [PMC5386646]. Furthermore, it was observed that the expression of hsa-mir-1912 was upregulated in response to various apoptosis-inducing agents [PMC5386646]. In summary, hsa-mir-1912 is a miRNA that has been shown to be up-regulated in certain conditions and in response to apoptosis-inducing agents. It has been identified as one of the up-regulated miRNAs along with other specific miRNAs. The highest upregulation of its expression was observed after etoposide treatment. These findings suggest that hsa-mir-1912 may play a role in apoptosis and could potentially serve as a biomarker for certain conditions or treatment responses. However, further research is needed to fully understand its function and clinical implications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACCCAGAGCAUGCAGUGUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Cavia porcellus Cpo-Mir-1912_3p (mature (guide))
  2. Oryctolagus cuniculus (rabbit) Ocu-Mir-1912_3p (mature (guide))
  3. Pongo pygmaeus ppy-miR-1912
Publications