Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3659 URS00004A6E26_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3659: Hsa-mir-3659 is a miRNA that has not been studied in relation to prostate cancer (PCa) [PMC8100013]. The expression of hsa-mir-3659 was analyzed using the 2-ΔΔCt method in conjunction with other miRNAs [PMC7719707]. In a study, the diagnostic value of the urinary hsv2-miR-H9 to hsa-mir-3659 expression ratio was determined as a non-invasive diagnostic marker for PCa [PMC8902421]. The expression ratio of urinary hsv2-miR-H9 to hsa-mir-3659 was calculated using RT-PCR and compared between PCa and benign prostatic hyperplasia (BPH) groups [PMC8902421]. Hsa-mir-3659 was found to be upregulated in non-responder patients [PMC5918871]. Additionally, hsa-mir-3659 was found to be upregulated in PDLSC after nicotine treatment, suggesting an effect of cigarette smoking on its expression [PMC5379007]. The specific forward primer for amplifying hsa-mir-3659 in PCR reactions is 5′-TGAGTGTTGTCTACGAGGGCA-3′ [PMC8902421][PMC5918871][PMC5379007][PMC4401551]. Hsa-mir-3659 is an unstudied miRNA that has been analyzed for its expression levels and diagnostic value in relation to prostate cancer. It has also been found to be upregulated in non-responder patients and after nicotine treatment.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGUGUUGUCUACGAGGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications