Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR393a URS00004A46D8_39947

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Oryza sativa Japonica Group. Annotated by 1 database (ENA). Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR393a sequence is a product of miR393, osa-miR393a, miR393a genes. Found in the japanese rice reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UCCAAAGGGAUCGCAUUGAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 140 other species

    1. Ananas comosus (pineapple) microRNA 393b
    2. Arabidopsis thaliana (thale cress) Ath_wt_07292
    3. Brachypodium distachyon bdi-miR393b-5p
    4. Brassica napus bna-miR393
    5. Citrus sinensis csi-miR393c-5p
    6. Cucumis melo cme-miR393a
    7. Cynara cardunculus var. scolymus cca-miR393b
    8. Fragaria vesca subsp. vesca fve-miR393a
    9. Glycine max gma-miR393a
    10. Helianthus annuus sRNA HannXRQ_Chr07g0206985
    11. Linum usitatissimum lus-miR393d
    12. Manihot esculenta (cassava) mes-miR393a
    13. Medicago truncatula mtr-miR393a
    14. Oryza sativa osa-miR393a
    15. Populus tomentosa Pto-miR393c
    16. Populus trichocarpa (black cottonwood) ptc-miR393c
    17. Prunus persica (peach) ppe-miR393b
    18. Ricinus communis (castor bean) rco-miR393
    19. Sorghum bicolor (sorghum) sbi-miR393b
    20. Theobroma cacao tcc-miR393b
    21. Vitis vinifera (wine grape) vvi-miR393a
    22. Vriesea carinata vca-miR393-5p