Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4763-3p URS00004A40D8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4763: Hsa-mir-4763 is a microRNA that may play a role in the aggressiveness of papillary thyroid microcarcinoma (PTMC) by regulating the expression of sarcoma gene (SRC) [PMC9281586]. In a study analyzing PTMC samples, the expression levels of hsa-mir-4763, hsa-miR-6775, and circRNA-000121 were compared between PTMC patients with and without lymph node metastasis [PMC9281586]. The study found that the expression of hsa-mir-4763 was reduced in PTMC, suggesting its involvement in PTMC aggressiveness [PMC9281586]. However, binary logistic regression analysis did not show a significant association between the expression levels of circRNA-000121, hsa-miR-6775, hsa-mir-4763, SRC, and matrix metalloproteinase 14 (MMP-14) with lymph node metastasis in PTMC tissues [PMC9281586]. Additionally, the levels of circRNA-000121 and circRNA-004183 in peripheral blood were not associated with lymph node metastasis [PMC9281586]. The study also suggested that circRNA-000121 may upregulate SRC expression by binding to hsa-mir-4763 and enhance PTMC aggressiveness leading to lymph node metastasis [PMC9281586]. However, it is worth noting that there is no clear evidence for the expression of annotated hsa-mir-4763 in brain samples or ENCODE cell lines. Furthermore, no expression was found for its orthologs in Macaca mulatta brain or domestic dog lymphocytes [PMC3384580]. Additionally, it was found that bta-mir2443 is not an orthologous sequence to hsa-mir4763 [PMC3384580].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGCAGGGGCUGGUGCUGGGCGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications