Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila melanogaster (fruit fly) microRNA dme-mir-125 precursor secondary structure diagram

Drosophila melanogaster (fruit fly) microRNA dme-mir-125 precursor URS00004A3361_7227

Automated summary: This pre miRNA sequence is 110 nucleotides long and is found in Drosophila melanogaster. Annotated by 4 databases (miRBase, FlyBase, RefSeq, ENA). Described in 18 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (lin-4, RF00052). Drosophila melanogaster (fruit fly) microRNA dme-mir-125 precursor sequence is a product of mir-125 precursor, dme-mir-125 precursor, 125, mir-125, 125 precursor RN, FBgn0262456, mir-125 precursor RNA, mir-125 precurso, 125 precursor RNA genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GACAUGUGCAAAUGUUUGUAUGGCUGAUUCCCUGAGACCCUAACUUGUGACUUUUAAUACCAGUUUCACAAGUUUUGAUCUCCGGUAUUGGACGCAAACUUGCUGAUGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 11 other species

    1. Drosophila ananassae microRNA dan-mir-125 precursor
    2. Drosophila erecta microRNA der-mir-125 precursor
    3. Drosophila grimshawi microRNA dgr-mir-125 precursor (dgr-mir-125-1, dgr-mir-125-2)
    4. Drosophila mojavensis microRNA dmo-mir-125 precursor
    5. Drosophila persimilis microRNA dpe-mir-125 precursor (dpe-mir-125 1 to 3)
    6. Drosophila pseudoobscura microRNA dps-mir-125 precursor
    7. Drosophila pseudoobscura pseudoobscura mir-125
    8. Drosophila sechellia microRNA dse-mir-125 precursor
    9. Drosophila simulans microRNA dsi-mir-125 precursor
    10. Drosophila virilis microRNA dvi-mir-125 precursor
    11. Drosophila willistoni microRNA dwi-mir-125 precursor
    12. Drosophila yakuba microRNA dya-mir-125 precursor
    2D structure New