Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3188 URS000049704B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3188: Hsa-mir-3188 is a type of up-regulated miRNA [PMC10011472]. In a study comparing differentially expressed miRNAs, hsa-mir-3188 was found to be up-regulated in patients with PCOS compared to controls with male factor infertility [PMC6579986]. Lentiviral particles carrying hsa-mir-3188 precursor were constructed for experimental purposes [PMC4842991]. The expression of hsa-mir-3188 was confirmed using qPCR [PMC6579986]. In another study, gene expression analysis showed that hsa-mir-3188 had lower expression levels at both 32°C and 39.5°C compared to 37°C [PMC4478345]. The sgRNAs targeting hsa-mir-3188 were designed for CRISPR experiments [PMC5563993].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAGGCUUUGUGCGGAUACGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications