Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3) secondary structure diagram

Saccharomyces cerevisiae S288C tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3) URS0000493157_559292

Automated summary: This tRNA sequence is 82 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 2 databases (ENA, GtRNAdb). Described in 6 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Saccharomyces cerevisiae S288C tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3) sequence is a product of tRNA-Leu-TAG-1-3, tRNA-Leu-TAG-1-2, tRNA-Leu-TAG-1-1 genes. Found in the Saccharomyces cerevisiae S288C reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGGAGUUUGGCCGAGUGGUUUAAGGCGUCAGAUUUAGGCUCUGAUAUCUUCGGAUGCAAGGGUUCGAAUCCCUUAGCUCUCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 131 other species

    1. Saccharomyces arboricola H-6 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    2. Saccharomyces boulardii (nom. inval.) tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    3. Saccharomyces cerevisiae AWRI796 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    4. Saccharomyces cerevisiae tRNA-Leu
    5. Saccharomyces cerevisiae CBS 7960 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    6. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    7. Saccharomyces cerevisiae CLIB215 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1, tRNA-Leu-TAG-1-2)
    8. Saccharomyces cerevisiae CLIB324 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 4)
    9. Saccharomyces cerevisiae CLIB382 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1, tRNA-Leu-TAG-1-2)
    10. Saccharomyces cerevisiae EC1118 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    11. Saccharomyces cerevisiae EC9-8 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    12. Saccharomyces cerevisiae FL100 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    13. Saccharomyces cerevisiae FostersB tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    14. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    15. Saccharomyces cerevisiae Lalvin QA23 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    16. Saccharomyces cerevisiae P283 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    17. Saccharomyces cerevisiae P301 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1, tRNA-Leu-TAG-1-2)
    18. Saccharomyces cerevisiae PE-2 tRNA-Leu
    19. Saccharomyces cerevisiae PW5 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1, tRNA-Leu-TAG-1-2)
    20. Saccharomyces cerevisiae R008 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    21. Saccharomyces cerevisiae R103 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    22. Saccharomyces cerevisiae RM11-1a tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    23. Saccharomyces cerevisiae Sigma1278b tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    24. Saccharomyces cerevisiae T73 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1, tRNA-Leu-TAG-1-2)
    25. Saccharomyces cerevisiae T7 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    26. Saccharomyces cerevisiae UC5 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1, tRNA-Leu-TAG-1-2)
    27. Saccharomyces cerevisiae UFMG A-905 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    28. Saccharomyces cerevisiae Vin13 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    29. Saccharomyces cerevisiae VL3 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    30. Saccharomyces cerevisiae W303 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    31. Saccharomyces cerevisiae Y10 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    32. Saccharomyces cerevisiae YJM1078 tRNA-Leu
    33. Saccharomyces cerevisiae YJM1083 tRNA-Leu
    34. Saccharomyces cerevisiae YJM1129 tRNA-Leu
    35. Saccharomyces cerevisiae YJM1133 tRNA-Leu
    36. Saccharomyces cerevisiae YJM1190 tRNA-Leu
    37. Saccharomyces cerevisiae YJM1199 tRNA-Leu
    38. Saccharomyces cerevisiae YJM1202 tRNA-Leu
    39. Saccharomyces cerevisiae YJM1208 tRNA-Leu
    40. Saccharomyces cerevisiae YJM1242 tRNA-Leu
    41. Saccharomyces cerevisiae YJM1244 tRNA-Leu
    42. Saccharomyces cerevisiae YJM1248 tRNA-Leu
    43. Saccharomyces cerevisiae YJM1250 tRNA-Leu
    44. Saccharomyces cerevisiae YJM1252 tRNA-Leu
    45. Saccharomyces cerevisiae YJM1273 tRNA-Leu
    46. Saccharomyces cerevisiae YJM1304 tRNA-Leu
    47. Saccharomyces cerevisiae YJM1307 tRNA-Leu
    48. Saccharomyces cerevisiae YJM1311 tRNA-Leu
    49. Saccharomyces cerevisiae YJM1326 tRNA-Leu
    50. Saccharomyces cerevisiae YJM1332 tRNA-Leu
    51. Saccharomyces cerevisiae YJM1336 tRNA-Leu
    52. Saccharomyces cerevisiae YJM1338 tRNA-Leu
    53. Saccharomyces cerevisiae YJM1341 tRNA-Leu
    54. Saccharomyces cerevisiae YJM1342 tRNA-Leu
    55. Saccharomyces cerevisiae YJM1355 tRNA-Leu
    56. Saccharomyces cerevisiae YJM1356 tRNA-Leu
    57. Saccharomyces cerevisiae YJM1381 tRNA-Leu
    58. Saccharomyces cerevisiae YJM1383 tRNA-Leu
    59. Saccharomyces cerevisiae YJM1385 tRNA-Leu
    60. Saccharomyces cerevisiae YJM1386 tRNA-Leu
    61. Saccharomyces cerevisiae YJM1387 tRNA-Leu
    62. Saccharomyces cerevisiae YJM1388 tRNA-Leu
    63. Saccharomyces cerevisiae YJM1389 tRNA-Leu
    64. Saccharomyces cerevisiae YJM1399 tRNA-Leu
    65. Saccharomyces cerevisiae YJM1400 tRNA-Leu
    66. Saccharomyces cerevisiae YJM1401 tRNA-Leu
    67. Saccharomyces cerevisiae YJM1402 tRNA-Leu
    68. Saccharomyces cerevisiae YJM1415 tRNA-Leu
    69. Saccharomyces cerevisiae YJM1417 tRNA-Leu
    70. Saccharomyces cerevisiae YJM1418 tRNA-Leu
    71. Saccharomyces cerevisiae YJM1419 tRNA-Leu
    72. Saccharomyces cerevisiae YJM1433 tRNA-Leu
    73. Saccharomyces cerevisiae YJM1434 tRNA-Leu
    74. Saccharomyces cerevisiae YJM1439 tRNA-Leu
    75. Saccharomyces cerevisiae YJM1443 tRNA-Leu
    76. Saccharomyces cerevisiae YJM1444 tRNA-Leu
    77. Saccharomyces cerevisiae YJM1447 tRNA-Leu
    78. Saccharomyces cerevisiae YJM1450 tRNA-Leu
    79. Saccharomyces cerevisiae YJM1460 tRNA-Leu
    80. Saccharomyces cerevisiae YJM1463 tRNA-Leu
    81. Saccharomyces cerevisiae YJM1477 tRNA-Leu
    82. Saccharomyces cerevisiae YJM1478 tRNA-Leu
    83. Saccharomyces cerevisiae YJM1479 tRNA-Leu
    84. Saccharomyces cerevisiae YJM1526 tRNA-Leu
    85. Saccharomyces cerevisiae YJM1527 tRNA-Leu
    86. Saccharomyces cerevisiae YJM1549 tRNA-Leu
    87. Saccharomyces cerevisiae YJM1573 tRNA-Leu
    88. Saccharomyces cerevisiae YJM1574 tRNA-Leu
    89. Saccharomyces cerevisiae YJM1592 tRNA-Leu
    90. Saccharomyces cerevisiae YJM1615 tRNA-Leu
    91. Saccharomyces cerevisiae YJM189 tRNA-Leu
    92. Saccharomyces cerevisiae YJM193 tRNA-Leu
    93. Saccharomyces cerevisiae YJM195 tRNA-Leu
    94. Saccharomyces cerevisiae YJM244 tRNA-Leu
    95. Saccharomyces cerevisiae YJM248 tRNA-Leu
    96. Saccharomyces cerevisiae YJM269 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    97. Saccharomyces cerevisiae YJM270 tRNA-Leu
    98. Saccharomyces cerevisiae YJM271 tRNA-Leu
    99. Saccharomyces cerevisiae YJM320 tRNA-Leu
    100. Saccharomyces cerevisiae YJM326 tRNA-Leu
    101. Saccharomyces cerevisiae YJM428 tRNA-Leu
    102. Saccharomyces cerevisiae YJM450 tRNA-Leu
    103. Saccharomyces cerevisiae YJM451 tRNA-Leu
    104. Saccharomyces cerevisiae YJM453 tRNA-Leu
    105. Saccharomyces cerevisiae YJM456 tRNA-Leu
    106. Saccharomyces cerevisiae YJM470 tRNA-Leu
    107. Saccharomyces cerevisiae YJM541 tRNA-Leu
    108. Saccharomyces cerevisiae YJM554 tRNA-Leu
    109. Saccharomyces cerevisiae YJM555 tRNA-Leu
    110. Saccharomyces cerevisiae YJM627 tRNA-Leu
    111. Saccharomyces cerevisiae YJM681 tRNA-Leu
    112. Saccharomyces cerevisiae YJM682 tRNA-Leu
    113. Saccharomyces cerevisiae YJM683 tRNA-Leu
    114. Saccharomyces cerevisiae YJM689 tRNA-Leu
    115. Saccharomyces cerevisiae YJM693 tRNA-Leu
    116. Saccharomyces cerevisiae YJM969 tRNA-Leu
    117. Saccharomyces cerevisiae YJM972 tRNA-Leu
    118. Saccharomyces cerevisiae YJM975 tRNA-Leu
    119. Saccharomyces cerevisiae YJM978 tRNA-Leu
    120. Saccharomyces cerevisiae YJM981 tRNA-Leu
    121. Saccharomyces cerevisiae YJM984 tRNA-Leu
    122. Saccharomyces cerevisiae YJM987 tRNA-Leu
    123. Saccharomyces cerevisiae YJM990 tRNA-Leu
    124. Saccharomyces cerevisiae YJM993 tRNA-Leu
    125. Saccharomyces cerevisiae YJM996 tRNA-Leu
    126. Saccharomyces cerevisiae YJSH1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    127. Saccharomyces kudriavzevii FM1078 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    128. Saccharomyces kudriavzevii IFO 1802 tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 3)
    129. Torulaspora delbrueckii tRNA-Leu (TAG) (tRNA-Leu-TAG-1 1 to 4)
    2D structure New