Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila willistoni dwi-miR-315 URS0000490BC9_7260

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUUGAUUGUUGCUCAGAAAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Aedes aegypti (yellow fever mosquito) aae-miR-315-5p
  2. Anopheles gambiae (African malaria mosquito) aga-miR-315
  3. Apis mellifera ame-miR-315-5p
  4. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-315
  5. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-315
  6. Culex quinquefasciatus cqu-miR-315
  7. Daphnia pulex dpu-miR-315
  8. Drosophila ananassae dan-miR-315
  9. Drosophila erecta der-miR-315
  10. Drosophila grimshawi dgr-miR-315
  11. Drosophila melanogaster dme-miR-315-5p
  12. Drosophila mojavensis dmo-miR-315
  13. Drosophila persimilis dpe-miR-315
  14. Drosophila pseudoobscura dps-miR-315
  15. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294505_df_nrg
  16. Drosophila sechellia dse-miR-315
  17. Drosophila simulans dsi-miR-315
  18. Drosophila yakuba dya-miR-315
  19. Nasonia longicornis nlo-miR-315
  20. Nasonia vitripennis (jewel wasp) nvi-miR-315
  21. Tribolium castaneum tca-miR-315