Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nasonia longicornis nlo-miR-315 URS0000490BC9_7427

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Nasonia longicornis. Annotated by 1 database (miRBase). Described in 0 papers.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUUUGAUUGUUGCUCAGAAAGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 20 other species

    1. Aedes aegypti (yellow fever mosquito) aae-miR-315-5p
    2. Anopheles gambiae aga-miR-315
    3. Apis mellifera ame-miR-315-5p
    4. Cochliomyia hominivorax mature cho-miR-315
    5. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-315
    6. Culex quinquefasciatus (southern house mosquito) cqu-miR-315
    7. Daphnia pulex dpu-miR-315
    8. Drosophila ananassae dan-miR-315
    9. Drosophila erecta der-miR-315
    10. Drosophila grimshawi dgr-miR-315
    11. Drosophila melanogaster dme-miR-315-5p
    12. Drosophila mojavensis dmo-miR-315
    13. Drosophila persimilis dpe-miR-315
    14. Drosophila pseudoobscura dps-miR-315
    15. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294505_df_nrg
    16. Drosophila sechellia dse-miR-315
    17. Drosophila simulans dsi-miR-315
    18. Drosophila willistoni dwi-miR-315
    19. Drosophila yakuba dya-miR-315
    20. Nasonia vitripennis nvi-miR-315
    21. Tribolium castaneum (red flour beetle) tca-miR-315