Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tribolium castaneum (red flour beetle) tca-miR-315 URS0000490BC9_7070

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Tribolium castaneum. Annotated by 3 databases (ENA, miRBase, RefSeq). Described in 3 papers. Tribolium castaneum (red flour beetle) tca-miR-315 sequence is a product of tca-miR-315, Mir315, miR-315 genes. Found in the red flour beetle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUUUGAUUGUUGCUCAGAAAGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 20 other species

    1. Aedes aegypti aae-miR-315-5p
    2. Anopheles gambiae (African malaria mosquito) aga-miR-315
    3. Apis mellifera (honey bee) ame-miR-315-5p
    4. Cochliomyia hominivorax mature cho-miR-315
    5. Cochliomyia macellaria mature cma-miR-315
    6. Culex quinquefasciatus (southern house mosquito) cqu-miR-315
    7. Daphnia pulex dpu-miR-315
    8. Drosophila ananassae dan-miR-315
    9. Drosophila erecta der-miR-315
    10. Drosophila grimshawi dgr-miR-315
    11. Drosophila melanogaster (fruit fly) dme-miR-315-5p
    12. Drosophila mojavensis dmo-miR-315
    13. Drosophila persimilis dpe-miR-315
    14. Drosophila pseudoobscura dps-miR-315
    15. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294505_df_nrg
    16. Drosophila sechellia dse-miR-315
    17. Drosophila simulans dsi-miR-315
    18. Drosophila willistoni dwi-miR-315
    19. Drosophila yakuba dya-miR-315
    20. Nasonia longicornis nlo-miR-315
    21. Nasonia vitripennis nvi-miR-315