Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-129-2-3p URS000048F59D_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (MalaCards, TarBase, MirGeneDB, LncBase, GeneCards, RefSeq, ENA, miRBase). Described in 47 papers. Homo sapiens (human) hsa-miR-129-2-3p sequence is a product of miR-129-2-3p, MIR129-2, hsa-miR-129-2-3p, hsa-mir-RG-113, mir-RG-113, miR-129-2, hsa-miR-129-2 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 133K02, 14-3-3-zeta, 16.3A5, 16E1BP, 17-1A, 1D, 2B4, 2F1, 30ST3A1, 323/A3.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAGCCCUUACCCCAAAAAGCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 52 other species

    1. Alligator mississippiensis ami-miR-129b-3p
    2. Anolis carolinensis Aca-Mir-129-P2_3p* (star (passenger))
    3. Bos taurus (cattle) bta-miR-129-3p
    4. Canis lupus familiaris (dog) Cfa-Mir-129-P2_3p* (star (passenger))
    5. Capra hircus chi-miR-129-3p
    6. Cavia porcellus cpo-miR-129-2-3p
    7. Cervus elaphus (red deer) cel-miR-129-3p
    8. Chiloscyllium plagiosum microRNA cpl-miR-129-1-3p
    9. Chrysemys picta bellii Cpi-Mir-129-P2_3p* (star (passenger))
    10. Danio rerio dre-miR-129-3p
    11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-129-2-3p
    12. Echinops telfairi Ete-Mir-129-P2_3p (mature (co-guide))
    13. Eptesicus fuscus (big brown bat) efu-miR-129a
    14. Equus caballus eca-miR-129b-3p
    15. Gadus morhua (Atlantic cod) gmo-miR-129-3p
    16. Gallus gallus (chicken) gga-miR-129-1-3p
    17. Macaca mulatta Mml-Mir-129-P2_3p (mature (guide))
    18. Mus musculus mmu-miR-129-2-3p
    19. Ophiophagus hannah oha-miR-129b-3p
    20. Ornithorhynchus anatinus Oan-Mir-129-P2_3p* (star (passenger))
    21. Oryctolagus cuniculus ocu-miR-129-2-3p
    22. Petromyzon marinus (sea lamprey) pma-miR-129a-3p
    23. Pongo pygmaeus ppy-miR-129-2-3p
    24. Pteropus alecto (black flying fox) pal-miR-129a-3p
    25. Python bivittatus pbv-miR-129b-3p
    26. Rattus norvegicus rno-miR-129-2-3p
    27. Salmo salar ssa-miR-129-3p
    28. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-129-P2_3p* (star (passenger))
    29. Sus scrofa ssc-miR-129a-3p
    30. Taeniopygia guttata (zebra finch) tgu-miR-129-3p
    31. Tor tambroides miR-129-3p
    32. Xenopus tropicalis Xtr-Mir-129-P2_3p* (star (passenger))