Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila yakuba microRNA dya-mir-9a precursor secondary structure diagram

Drosophila yakuba microRNA dya-mir-9a precursor URS0000489A4A_7245

Automated summary: This pre miRNA sequence is 78 nucleotides long and is found in Drosophila yakuba. Annotated by 3 databases (Ensembl Metazoa, miRBase, ENA). Described in 3 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-9, RF00237). Drosophila yakuba microRNA dya-mir-9a precursor sequence is a product of 9a-1 precursor RNA, FBgn0258416, 9a-2 precursor RN, 9a-1 precursor RN, mir-9a-1 precursor RNA, mir-9a-2 precursor RNA, FBgn0258397, Dyak\mir-9a-2, 9a-2 precursor RNA, Dyak\mir-9a-1 genes. Found in the Drosophila yakuba reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GCUAUGUUGUCUUUGGUUAUCUAGCUGUAUGAGUGAUAAAUAACGUCAUAAAGCUAGCUUACCGAAGUUAAUAUUAGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 7 other species

    1. Drosophila ananassae microRNA dan-mir-9a precursor
    2. Drosophila erecta microRNA der-mir-9a precursor
    3. Drosophila melanogaster microRNA dme-mir-9a precursor
    4. Drosophila persimilis microRNA dpe-mir-9a precursor
    5. Drosophila pseudoobscura microRNA dps-mir-9a precursor
    6. Drosophila pseudoobscura pseudoobscura mir-9a
    7. Drosophila sechellia microRNA dse-mir-9a precursor
    8. Drosophila simulans microRNA dsi-mir-9a precursor
    2D structure New