Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-135b-3p URS0000488C83_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 6 databases (miRBase, RefSeq, LncBase, ENA, TarBase, MirGeneDB). Described in 23 papers. Mus musculus (house mouse) mmu-miR-135b-3p sequence is a product of miR-135b, mmu-miR-135b-3p, Mir135b, miR-135b-3p, miR-135, mmu-miR-135b genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1300001I01Rik, 1300007E16Rik, 3300002C04Rik, Cct6, Cct6a, Cctz-1, Cluh, ENSMUSG00000003970, ENSMUSG00000006456, ENSMUSG00000011008.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUGUAGGGCUAAAAGCCAUGGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 25 other species

    1. Alligator mississippiensis Ami-Mir-135-P3_3p* (star (passenger))
    2. Anolis carolinensis Aca-Mir-135-P3_3p* (star (passenger))
    3. Bos taurus (cattle) Bta-Mir-135-P3_3p* (star (passenger))
    4. Canis lupus familiaris (dog) Cfa-Mir-135-P3_3p* (star (passenger))
    5. Cavia porcellus cpo-miR-135b-3p
    6. Chrysemys picta bellii Cpi-Mir-135-P3_3p* (star (passenger))
    7. Chrysemys picta cpi-miR-135-3-3p
    8. Echinops telfairi Ete-Mir-135-P3_3p* (star (passenger))
    9. Homo sapiens (human) hsa-miR-135b-3p
    10. Macaca mulatta mml-miR-135b-3p
    11. Monodelphis domestica (gray short-tailed opossum) mdo-miR-135b-3p
    12. Ophiophagus hannah oha-miR-135-3-3p
    13. Oryctolagus cuniculus ocu-miR-135b-3p
    14. Python bivittatus pbv-miR-135-3-3p
    15. Rattus norvegicus rno-miR-135b-3p
    16. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-135-P3_3p* (star (passenger))
    17. Sus scrofa ssc-mir188