Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-133a-3p URS00004883E0_9031

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (MirGeneDB, RefSeq, ENA, miRBase). Gallus gallus (chicken) gga-miR-133a-3p sequence is a product of miR-133, MIR133A2, gga-miR-133a, MIR133A1, miR-133a-3p, miR-133a, gga-miR-133a-3p genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUGGUCCCCUUCAACCAGCUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 100 other species

    1. Aedes aegypti aae-miR-133
    2. Alligator mississippiensis Ami-Mir-133-P1-v2_3p (mature (guide))
    3. Anolis carolinensis Aca-Mir-133-P1-v2_3p (mature (guide))
    4. Anopheles gambiae aga-miR-133
    5. Apis mellifera (honey bee) ame-miR-133-3p
    6. Ateles geoffroyi age-miR-133a
    7. Blattella germanica Bge-Mir-133_3p (mature (guide))
    8. Bombyx mori bmo-miR-133
    9. Bos taurus Bta-Mir-133-P1-v2_3p (mature (guide))
    10. Branchiostoma belcheri bbe-miR-133-5p
    11. Branchiostoma floridae (Florida lancelet) Bfl-Mir-133-v2_3p (mature (guide))
    12. Branchiostoma lanceolatum Bla-Mir-133-v2_3p (mature (guide))
    13. Callithrix jacchus cja-miR-133a
    14. Callorhinchus milii Cmi-Mir-133-P4-v2_3p (mature (guide))
    15. Canis lupus familiaris cfa-miR-133a
    16. Capitella teleta cte-miR-133
    17. Cavia porcellus (domestic guinea pig) Cpo-Mir-133-P1-v2_3p (mature (guide))
    18. Centruroides sculpturatus (bark scorpion) Csc-Mir-133-P18_3p (mature (guide))
    19. Cervus elaphus (red deer) cel-miR-133a
    20. Chiloscyllium plagiosum microRNA cpl-miR-133
    21. Chrysemys picta bellii Cpi-Mir-133-P1-v2_3p (mature (guide))
    22. Cochliomyia hominivorax mature cho-miR-133
    23. Cochliomyia macellaria mature cma-miR-133
    24. Columba livia Cli-Mir-133-P1-v2_3p (mature (guide))
    25. Crassostrea gigas (Pacific oyster) Cgi-Mir-133_3p (mature (guide))
    26. Culex quinquefasciatus cqu-miR-133
    27. Cyprinus carpio (common carp) ccr-miR-133a-3p
    28. Danio rerio Dre-Mir-133-P1-v2_3p (mature (guide))
    29. Daphnia magna Dma-Mir-133_3p (mature (guide))
    30. Daphnia pulex dpu-miR-133
    31. Dasypus novemcinctus Dno-Mir-133-P1-v2_3p (mature (guide))
    32. Dinoponera quadriceps dqu-miR-133-3p
    33. Drosophila ananassae dan-miR-133
    34. Drosophila erecta der-miR-133
    35. Drosophila grimshawi dgr-miR-133
    36. Drosophila melanogaster dme-miR-133-3p
    37. Drosophila mojavensis dmo-miR-133
    38. Drosophila persimilis dpe-miR-133
    39. Drosophila pseudoobscura dps-miR-133
    40. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294465_df_nrg
    41. Drosophila sechellia dse-miR-133
    42. Drosophila simulans dsi-miR-133
    43. Drosophila virilis dvi-miR-133-3p
    44. Drosophila willistoni dwi-miR-133
    45. Drosophila yakuba dya-miR-133
    46. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-133-P1-v2_3p (mature (guide))
    47. Eptatretus burgeri Ebu-Mir-133-P6b-v2_3p (mature (guide))
    48. Euprymna scolopes Esc-Mir-133_3p (mature (guide))
    49. Gadus morhua gmo-miR-133a-3p
    50. Gekko japonicus Gja-Mir-133-P1-v2_3p (mature (guide))
    51. Gorilla gorilla ggo-miR-133a
    52. Haplochromis burtoni abu-miR-133a
    53. Heliconius melpomene (postman butterfly) Hme-Mir-133_3p (mature (guide))
    54. Homo sapiens (human) Hsa-Mir-133-P1-v2_3p (mature (guide))
    55. Hyalella azteca miR-133
    56. Ictalurus punctatus ipu-miR-133a
    57. Ixodes scapularis (black-legged tick) isc-miR-133
    58. Lagothrix lagotricha lla-miR-133a
    59. Lepisosteus oculatus (spotted gar) Loc-Mir-133-P1-v2_3p (mature (guide))
    60. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-133-P12_3p (mature (guide))
    61. Lingula anatina Lan-Mir-133_3p (mature (guide))
    62. Lottia gigantea (owl limpet) lgi-miR-133-3p
    63. Macaca mulatta (Rhesus monkey) Mml-Mir-133-P1-v2_3p (mature (guide))
    64. Macaca nemestrina (pig-tailed macaque) mne-miR-133a
    65. Manduca sexta mse-miR-133
    66. Maylandia zebra mze-miR-133a
    67. Microcaecilia unicolor Mun-Mir-133-P1-v2_3p (mature (guide))
    68. Monodelphis domestica (gray short-tailed opossum) mdo-miR-133a-3p
    69. Monopterus albus Mal-Mir-133-P1-v2_3p (mature (guide))
    70. Mus musculus (house mouse) Mmu-Mir-133-P1-v2_3p (mature (guide))
    71. Nasonia giraulti ngi-miR-133
    72. Nasonia longicornis nlo-miR-133
    73. Nasonia vitripennis nvi-miR-133
    74. Nautilus pompilius Npo-Mir-133-P20_3p (mature (guide))
    75. Neolamprologus brichardi nbr-miR-133a
    76. Octopus bimaculoides Obi-Mir-133_3p (mature (guide))
    77. Octopus vulgaris Ovu-Mir-133_3p (mature (guide))
    78. Oreochromis niloticus (Nile tilapia) oni-miR-133a
    79. Ornithorhynchus anatinus oan-miR-133a-3p
    80. Oryctolagus cuniculus Ocu-Mir-133-P1-v2_3p (mature (guide))
    81. Ovis aries (sheep) oar-miR-133
    82. Pan paniscus ppa-miR-133a
    83. Penaeus japonicus miR-133
    84. Polistes canadensis pca-miR-133-3p
    85. Pteropus alecto pal-miR-133a-3p
    86. Ptychodera flava Pfl-Mir-133-v2_3p (mature (guide))
    87. Python bivittatus Pbv-Mir-133-P1-v2_3p (mature (guide))
    88. Rattus norvegicus (Norway rat) Rno-Mir-133-P1-v2_3p (mature (guide))
    89. Saccoglossus kowalevskii sko-miR-133
    90. Saguinus labiatus sla-miR-133a
    91. Salmo salar (Atlantic salmon) ssa-miR-133a-3p
    92. Sarcophilus harrisii Sha-Mir-133-P1-v2_3p (mature (guide))
    93. Scyliorhinus torazame (cloudy catshark) Sto-Mir-133-P1-v2_3p (mature (guide))
    94. Taeniopygia guttata Tgu-Mir-133-P1-v2_3p (mature (guide))
    95. Tetranychus urticae tur-miR-133-3p
    96. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-133-P1-v2_3p (mature (guide))
    97. Tribolium castaneum (red flour beetle) tca-miR-133-3p
    98. Triops cancriformis tcf-miR-133
    99. Xenopus laevis (African clawed frog) xla-miR-133a
    100. Xenopus tropicalis xtr-miR-133a
    Publications New