Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus laevis (African clawed frog) xla-miR-133a URS00004883E0_8355

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Xenopus laevis. Annotated by 1 database (miRBase). Described in 0 papers.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUGGUCCCCUUCAACCAGCUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 83 other species

    1. Aedes aegypti aae-miR-133
    2. Alligator mississippiensis (American alligator) Ami-Mir-133-P1-v2_3p (mature (guide))
    3. Anolis carolinensis (green anole) Aca-Mir-133-P1-v2_3p (mature (guide))
    4. Anopheles gambiae (African malaria mosquito) aga-miR-133
    5. Apis mellifera (honey bee) ame-miR-133-3p
    6. Ateles geoffroyi age-miR-133a
    7. Blattella germanica (German cockroach) Bge-Mir-133_3p (mature (guide))
    8. Bombyx mori (domestic silkworm) bmo-miR-133
    9. Bos taurus Bta-Mir-133-P1-v2_3p (mature (guide))
    10. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-133-5p
    11. Branchiostoma floridae (Florida lancelet) Bfl-Mir-133-v2_3p (mature (guide))
    12. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-133a
    13. Callorhinchus milii eshark_mir-133_4
    14. Canis lupus familiaris cfa-miR-133a
    15. Capitella teleta cte-miR-133
    16. Cavia porcellus (domestic guinea pig) Cpo-Mir-133-P1-v2_3p (mature (guide))
    17. Cervus elaphus cel-miR-133a
    18. Chiloscyllium plagiosum microRNA cpl-miR-133
    19. Chrysemys picta bellii (western painted turtle) Cpi-Mir-133-P1-v2_3p (mature (guide))
    20. Cochliomyia hominivorax mature cho-miR-133
    21. Cochliomyia macellaria mature cma-miR-133
    22. Columba livia (rock pigeon) Cli-Mir-133-P1-v2_3p (mature (guide))
    23. Crassostrea gigas Cgi-Mir-133-v1_3p (mature (guide))
    24. Culex quinquefasciatus (southern house mosquito) cqu-miR-133
    25. Cyprinus carpio (common carp) ccr-miR-133a-3p
    26. Danio rerio Dre-Mir-133-P1-v2_3p (mature (guide))
    27. Daphnia pulex dpu-miR-133
    28. Dasypus novemcinctus Dno-Mir-133-P1-v2_3p (mature (guide))
    29. Dinoponera quadriceps dqu-miR-133-3p
    30. Drosophila ananassae dan-miR-133
    31. Drosophila erecta der-miR-133
    32. Drosophila grimshawi dgr-miR-133
    33. Drosophila melanogaster (fruit fly) dme-miR-133-3p
    34. Drosophila mojavensis dmo-miR-133
    35. Drosophila persimilis dpe-miR-133
    36. Drosophila pseudoobscura dps-miR-133
    37. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294465_df_nrg
    38. Drosophila sechellia dse-miR-133
    39. Drosophila simulans dsi-miR-133
    40. Drosophila virilis dvi-miR-133-3p
    41. Drosophila willistoni dwi-miR-133
    42. Drosophila yakuba dya-miR-133
    43. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-133-P1-v2_3p (mature (guide))
    44. Gadus morhua (Atlantic cod) gmo-miR-133a-3p
    45. Gallus gallus gga-miR-133a-3p
    46. Gorilla gorilla (western gorilla) ggo-miR-133a
    47. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-133a
    48. Heliconius melpomene (postman butterfly) Hme-Mir-133_3p (mature (guide))
    49. Homo sapiens Hsa-Mir-133-P1-v2_3p (mature (guide))
    50. Ictalurus punctatus ipu-miR-133a
    51. Ixodes scapularis (black-legged tick) isc-miR-133
    52. Lagothrix lagotricha lla-miR-133a
    53. Lingula anatina Lan-Mir-133_3p (mature (guide))
    54. Lottia gigantea (owl limpet) lgi-miR-133-3p
    55. Macaca mulatta (Rhesus monkey) Mml-Mir-133-P1-v2_3p (mature (guide))
    56. Macaca nemestrina (pig-tailed macaque) mne-miR-133a
    57. Manduca sexta mse-miR-133
    58. Maylandia zebra (zebra mbuna) mze-miR-133a
    59. Monodelphis domestica (gray short-tailed opossum) mdo-miR-133a-3p
    60. Mus musculus Mmu-Mir-133-P1-v2_3p (mature (guide))
    61. Nasonia giraulti ngi-miR-133
    62. Nasonia longicornis nlo-miR-133
    63. Nasonia vitripennis nvi-miR-133
    64. Neolamprologus brichardi nbr-miR-133a
    65. Oreochromis niloticus oni-miR-133a
    66. Ornithorhynchus anatinus oan-miR-133a-3p
    67. Oryctolagus cuniculus (rabbit) Ocu-Mir-133-P2-v2_3p (mature (guide))
    68. Ovis aries (sheep) oar-miR-133
    69. Pan paniscus ppa-miR-133a
    70. Penaeus japonicus miR-133
    71. Polistes canadensis pca-miR-133-3p
    72. Pteropus alecto (black flying fox) pal-miR-133a-3p
    73. Ptychodera flava Pfl-Mir-133-v2_3p (mature (guide))
    74. Rattus norvegicus Rno-Mir-133-P1-v2_3p (mature (guide))
    75. Saccoglossus kowalevskii sko-miR-133
    76. Saguinus labiatus sla-miR-133a
    77. Salmo salar ssa-miR-133a-3p
    78. Sarcophilus harrisii Sha-Mir-133-P1-v2_3p (mature (guide))
    79. Scyliorhinus torazame Sto-Mir-133-P1-v2_3p (mature (guide))
    80. Taeniopygia guttata (zebra finch) Tgu-Mir-133-P1-v2_3p (mature (guide))
    81. Tetranychus urticae (two-spotted spider mite) tur-miR-133-3p
    82. Tribolium castaneum (red flour beetle) tca-miR-133-3p
    83. Triops cancriformis tcf-miR-133
    84. Xenopus tropicalis (tropical clawed frog) xtr-miR-133a