Homo sapiens (human) WASHC5 antisense RNA 1 (WASHC5-AS1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) WASHC5 antisense RNA 1 (WASHC5-AS1) URS00004847F3_9606

587 nucleotides
9 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, LncBook, MalaCards, NONCODE, RefSeq)
Found in 0 other species
2 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

WASHC5-AS1: WASHC5-AS1 is a long non-coding RNA (lncRNA) that has been implicated in various biological processes and diseases [PMC7388210]. In a study, WASHC5-AS1 was found to be associated with the Wnt signaling pathway and indirectly regulated the gene SFRP5, suggesting its potential role in influencing this pathway and the development of acute myeloid leukemia (AML) [PMC7388210]. Additionally, WASHC5-AS1 was identified as one of the 15 prognostic lncRNAs related to exosomes in breast cancer patients [PMC9789946]. The study established a 15-lncRNA prognostic signature that included WASHC5-AS1, along with other lncRNAs such as MEF2C-AS1, SOCS3-DT, LINC01711, and MRPL20-DT [PMC9789946]. The expression levels of these lncRNAs were used to calculate a risk score for assessing overall survival in breast cancer patients [PMC9789946]. These findings highlight the potential significance of WASHC5-AS1 in cancer development and prognosis. Further research is needed to elucidate its precise mechanisms of action and explore its therapeutic potential.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AUUUCUCUUUCCUGUUGCCAUGUGAAGAAGGACAUGUUUGCUUCCACUUCCACCAUGGUUGUAAGUUUCCUGAGGCCUCCACAGCCAUGCUGAACUGGUGGCAGAAAACAGGCAUGAAAGUCAAAAGGCUCACCUGUAACUCUUUUACAAUCAUAAAGCACAGAAGCCUGUCUAAGCCAUUUAGACCAAAGGUUCCCAAGGUGGUCUGGAUUUCUGAGAAGAGGCGGCUGCUGGUCACUUCCUGAUGAGUUUUCAUAUCAUACCAAGUGUUCAGCUGGUCUAUGUGACAUGUCAUUCUAAAAUGAAAACAAUGCAAAAACCCCAGAAUGGCUCAGAAUUCAUCCUUAAAGAGAUGUUAGGACUCAACAGGACAUGCGGCACCAAAUAUGAAGAACAGGAGUUACAUGAUCUGUGUUUUCUAACCUCUGUAUUCAGGCACCCAAUGCGUCUUCCCAGUGACACCCAAUGGAACAGGAAGGUAAAAUUCAGUCUGACCCCCUUUUCCUGCCCUAUGCCAUAUCAUUGGUUUCAGUCAUUUAUUUCCAUUGAGUUAGGGUGUUGACUUGGAAUCAUGCUGAGAAGACAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications