Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 14A (SNORA14A) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 14A (SNORA14A) URS0000481B37_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA14A: SNORA14A is a small nucleolar RNA that functions as a ribonucleoprotein (RNP) enzyme in the processing of ribosomal RNAs (rRNAs) and small nuclear RNAs (snRNAs) [PMC4633097]. To further investigate how the steady-state SNORA14A level was reduced in HB, we performed RNA decay assays and found that the half-life of SNORA14A in HB cells was obviously shorter than that in THLE-2 cells [PMC9886955]. This suggests that there may be dysregulation in the degradation or turnover of SNORA14A in HB cells. Additionally, SNORA38B and SNORA7B were also identified as top genes in the study, both of which are small nucleolar RNAs involved in RNP enzyme activity [PMC4633097]. These findings highlight the potential role of small nucleolar RNAs, including SNORA14A, SNORA38B, and SNORA7B, in the processing of rRNAs and snRNAs. Further research is needed to elucidate the specific mechanisms underlying the reduction of steady-state levels and shorter half-life of SNORA14A in HB cells compared to THLE-2 cells [PMC9886955]. Understanding these mechanisms may provide insights into potential therapeutic targets for hepatoblastoma.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCAUUCUUAAACCCUCUUGGUGGCUUCCCUGUAAAUGCUUCCAAGAUAUGAGCGAAUGCUAUAGAAAUUGCAGGAAAGUCCAAAGGGCUGCGCGUCUCCUGUGGCUCAGUCUUAUUUCAUACCUGCAACAUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications